1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RSB [31]
3 years ago
10

Which statement best describes homeostasis in a cell?

Biology
1 answer:
aleksandr82 [10.1K]3 years ago
6 0

Answer:

I believe the answer is A. The cell is in an equilibrium inside and out when it goes through homeostasis.

Explanation:

You might be interested in
Identify the structures in the cell pictured on the right<br> Label a,b,c,and d<br> 30 points
yulyashka [42]

The labeling of the cell represents.

The label A is Nucleus: The nucleus of the cell carries the hereditary material DNA from one generation to another generation. This carries the traits from one generation to another.

The label B is Cytoplasm: This is the fluid part of the cell which has all the organelles floating in it.

The label C is ribosomes: It is the an organelle present in that that is responsible for the protein synthesis.

The label D is Nucleolus: It is known to be the largest structure in the nucleus of the eukaryotic cell. It helps in the signal recognition pathway.

3 0
3 years ago
Read 2 more answers
The technique of severing the connections between the frontal lobe and the thalamus is called:
vivado [14]
The answer is lobotomy
7 0
4 years ago
I need help!!<br><br> Describe how desertification has impacted the environment of this area.
iogann1982 [59]
Desertification is the process where fertile land becomes a desert.

Well one way desertification could impact an environment could be by a problem called OVERGRAZING.

Overgrazing happens when goats and cattle are kept in the same area for too long which results in then eating all the vegetation. If all vegetation is eaten, it is unlikely for it to grown back. Changes in political boundaries and companies buying land means that farmers rely on the water and land around them. This means farmers don't regularly move to new fertile areas.
4 0
3 years ago
10 point
anastassius [24]

Answer:

Phosphorus is a significant components in the makeup of lipid bilayer.

Phosphorus is a component of

bones.

Phosphorus is a key nutrient to increase crop yield.

Explanation:

Phosphorus is an element that exist in two forms as either red phosphorus or white phosphorus. It is not found on Earth because it is very reactive. Phosphorus. It is the second most plentiful mineral in the body and it makes up to 1% weight of the food. It is found in food such as meat. It is a major component of lipid bilayer. It is a component of bones and teeth. It play important roles in photosynthesis by capturing and converting sun light energy into useful compounds. It is important to increase plants yield.

Phosphorus cycle is the movement of phosphorus from the atmosphere to the Earth and back to the atmosphere.

8 0
4 years ago
Help please, I will gibe brainly for the correct answer!
arsen [322]

We can conclude that, Barbie's choices are <u>egocentric</u> which indicates her being in the <u>preoperational stage</u> of Piaget's theory of cognitive development.

People who use a biopsychosocial approach are most likely to gain a: <em>comprehensive understanding of an individual's development.</em>

<em />

<h3>What is the Preoperational Stage?</h3>

The preoperational stage is the second stage in Piaget's theory of cognitive development, which is characterized by:

  • Egocentrism
  • Symbolic representation

The preoperational stage begins from 2 years of age up to 5 years of age. At this stage, children tend to use symbols to represent their own world.

According to Piaget, children tend to be egocentric during the preoperational stage, which explains why Chloe will get a gift like a Barbie doll for her dad. This shows Chloe, at this stage, cannot understand that her dad think in a different way she thinks.

Therefore, we can conclude that, Barbie's choices are <u>egocentric</u> which indicates her being in the <u>preoperational stage</u> of Piaget's theory of cognitive development.

<h3>What is the Biopsychosocial Approach?</h3>

In psychology, the biopsychosocial approach is a wide approach that takes into consideration biological, social, and psychological factors, and how they interact to influence health care delivery, illness and health.

Therefore, people who use a biopsychosocial approach are most likely to gain a: <em>comprehensive understanding of an individual's development.</em>

<em />

Learn more about the preoperational stage on:

brainly.com/question/9037764

6 0
3 years ago
Other questions:
  • When the environmental temperature is 33 degrees c vasodilation of cutaneous blood vessels helps to regulate the body temperatur
    7·1 answer
  • A complete soil profile includes three layers—
    15·1 answer
  • A confirmed hiv positive patient who presents to the clinic for a medication refill for a condition not related to his hiv. what
    13·1 answer
  • Scientists today can use experimental methods to study evolution. Which method was developed after Darwin’s time
    8·1 answer
  • A syncopal episode would consist of all of these signs except​ ________.
    13·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • The process in which plants draw water from their roots to their leaves where it evaporates into the atmosphere is called ______
    10·2 answers
  • DNA sequence:<br> TACTAGCTAACC<br> What would the complementary mRNA strand be?
    9·1 answer
  • PLEASEEE HELPPP!! what is an example of an energy transfer in the picture?
    13·2 answers
  • A male bird is homozygous recessive for both wacky wings (w) and flashy feathers (f). He is crossed with a female who is homozyg
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!