1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kobotan [32]
3 years ago
14

Can someone answer this quickly ASAP !!!!!

Biology
2 answers:
Alborosie3 years ago
8 0
The correct answer is 240
Elan Coil [88]3 years ago
6 0
240 milliliter is the answer
You might be interested in
Which of the bonding types below would be used between a positive sodium ion and negative bromide ion?
Feliz [49]

Answer:

Ionic bonding When metals react with non-metals, electrons are transferred from the metal atoms to the non-metal atoms, forming ions . The resulting compound is called an ionic compound .

Explanation:

7 0
3 years ago
Read 2 more answers
The middle segment of the small intestine
rewona [7]

Answer:

B. Jejunum

Explanation:

The segments constituents of the small intestine, in order from stomach to large intestine are: C. Duodenum, B. Jejunum, and E. Ileum.

3 0
2 years ago
A recent increase in pesticide use has resulted in a decrease in the local bat population. What is the BEST explanation for the
yulyashka [42]

Answer: 1. (A bat food supply decreased.)

Explanation:

7 0
2 years ago
Which principle states that animals succeed each other in a definite sequence?
muminat
The answer is faunal succession
3 0
3 years ago
Read 2 more answers
Population genetics is the study of _______.
Mrrafil [7]

According to the research, the correct option is A, population genetics is the study of how allele frequencies in a population change over time.

<h3>What is population genetics?</h3>

It studies the origin, amount and distribution of genetic variability present in populations.

It explains the variation between individuals, as well as the dynamics of alleles and genotypes within and between populations.

Therefore, we can conclude that according to the research, the correct option is A, population genetics is the study of how allele frequencies in a population change over time.

Learn more about population genetics here: brainly.com/question/13049509

#SPJ1

7 0
2 years ago
Other questions:
  • A science student makes the following statement
    6·2 answers
  • Why do hydras use its stinging cells?
    5·2 answers
  • the inability of an organism to produce certain proteins can occur when an organism is lacking am enzyme needed to combine
    7·1 answer
  • How does carbon enter the soil?
    10·2 answers
  • Seeds can grow into which of the following types of plants?
    8·2 answers
  • Explain why SARS-COV-2 is classed as a pathogen
    12·1 answer
  • Please help me with this biology thing.
    5·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Question reply thank you
    8·1 answer
  • 11
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!