1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hodyreva [135]
4 years ago
6

Which of the following is a property of the stem of a dicot plant?Select one of the options below as your answer:A. ground tissu

e is differentiated into pith and cortexB. vascular bundles are arranged sporadicallyC. no cambium between the xylem and phloem
Biology
1 answer:
Elodia [21]4 years ago
4 0
I think the correct answer from the choices listed above is option A. A property of the stem of a dicot plant is that the ground tissue is differentiated into pith and cortex. Vascular bundles are not arranged sporadically instead arranged in a ring. Also, cambium does exist between xylem and phloem.
You might be interested in
"Old-fashioned telephone systems relied on operators to take incoming calls and connect them to the appropriate persons they wer
Ghella [55]

Answer:

The thalamus of the brain functions in this analogous manner.

Explanation:

The thalamus (dorsal and ventral thalamus) is a structure located in the forebrain, at the base of the cerebrum. It acts as a relay center with nerve fibers project out to the cerebral cortex in all directions.

The thalamus is mainly made up of gray matter and contains a small amount of white matter. The grey matter, which is divided into the anterior part, medial and dorsal part contains several nuclei that interconnect brain activity between different areas of the brain. The anterior part contains anterior thalamic nuclei, medial part contains dorsomedial nuclei and the lateral part contains dorsal tier and ventral tier nuclei. Interlaminar nuclei , reticular nuclei, medial geniculate body , lateral geniculate body, etc are other nuclei present in the thalamus.

The thalamus receives sensory information from the various receptors in the body. It relays this sensory information to the cerebral cortex, where it is interpreted as pain, touch, temperature, etc. The various functions of thalamus include the integration of sensory information, emotional control, motor control, integration of sensations with emotions, regulation of consciousness, sleep, and alertness.

5 0
3 years ago
A scientist wants to determine which fertilizer is more effective—Fertilizer X or Fertilizer Y. The best way for her to proceed
tamaranim1 [39]
C because we are testing the effectiveness of Fertilizer X and Y and using no fertilizer can help determine if that would be better than using a fertilizer. Additionally, a control group of no fertilizer would be the third plant as that is considered normal for the experiment. Msg me for any more questions
7 0
3 years ago
Read 2 more answers
What is your preliminary idea(s) of the species of bacteria responsible for anna's infection? has your idea changed since the la
Hunter-Best [27]

For Anna’s case, my preliminary idea of the species of bacteria responsible for Anna’s infection is a Gram-negative bacterium as observed in gross examination of the colony. With this, my <span>idea has not changed since the last activity for the bacteria was rod-shaped when we view it through a microscope and the color of the colonies was pink after we Gram stained it, which indicate that it is Gram-negative.</span>

 

 

8 0
3 years ago
You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATT
Gwar [14]

Answer:

* (Stop) - Arg - Cys - Phe - Ala - Gly - Pro - Cys - Gly - Asn - Lys - Pro - Phe - Ile - Phe - Ile

Explanation:

This question involves gene expression, which consists of transcription and translation. The process of transcription involves synthesis of mRNA from DNA template as follows:

DNA - mRNA

ATT - UAA

GCC - CGG

ATG - UAC

AAA - UUU

CGC - GCG

CCC - GGG

GGT - CCA

ACA - UGU

CCA - GGU

TTG - AAC

TTC - AAG

GGC - CCG

AAA - UUU

TAA - AUU

AAA - UUU

TAA - AUU

Using the codon chart, each mRNA codon is translated into an amino acid as follows:

* (Stop) - Arg - Cys - Phe - Ala - Gly - Pro - Cys - Gly - Asn - Lys - Pro - Phe - Ile - Phe - Ile

3 0
3 years ago
A gummy bear is made up of sugar and gelatin, among other things. If a gummy bear sits in water, what will occur? Think about so
Scorpion4ik [409]

Answer:

The correct answer is D) The gummy bear will increase in size because of osmosis or the movement of water into the cell.

Explanation:

As the gummy bear contain sugar an gelatin,its osmotic pressure is greater than that of water.So when a gummy bear sits in water, the water molecules is transported into cell of that gummy bear because gummy bear is hypertonic to water in which it sits.

     As a result the gummy bear will increase in size.

8 0
4 years ago
Read 2 more answers
Other questions:
  • Which of these animal would most likely produce antifreeze compound in its cell?
    5·1 answer
  • Help ASAP!!!PLZ Which of the following could result from an algal bloom in a river?
    10·2 answers
  • Advantage of using a resource person
    7·1 answer
  • A temperature of 34f is equal to
    9·2 answers
  • The parents of a school-aged child with cystic fibrosis tell the nurse that they have changed to natural pancreatic enzymes beca
    7·1 answer
  • What is abiotic? <br> Tree sap?<br> Insect?<br> Sunlight?<br> Wood table?
    7·1 answer
  • How do lipids affect the human body?
    7·2 answers
  • Distinguish between Diet and Nutrition
    13·2 answers
  • The movement of the Earth around its own axis is called _____.
    10·2 answers
  • What element has 52 protons and has a mass number of 127??
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!