1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Travka [436]
3 years ago
5

An organism with two different genes for a specific trait is said to be _______. select one:

Biology
1 answer:
Reptile [31]3 years ago
5 0
An organism with two different genes for a specific trait is said to be “heterozygous” (b).
You might be interested in
Which of the following is most important in forming ATP?
icang [17]
Phosphorus is the most important element in forming ATP
<span>
During cellular respiration, the food molecules such as glucose, are oxidized to carbon dioxide (CO2) and water (H2O) and trapped in ATP (Adenosine triphosphate) form for further us of cell’s activities. ATP’s are formed at mitochondria – the cell’s powerhouse. This type of organelle takes and breaks nutrients absorbed by the cell and creates energy afterward. The energy from ATP is then used by the body in kinetic activities like running & walking or involuntary activities like breathing, blood circulation, stimulus-responding, etc.</span>
4 0
3 years ago
Read 2 more answers
Is a river an abiotic or biotic factor
WINSTONCH [101]
It’s an abiotic factor because it’s not living.
3 0
3 years ago
Read 2 more answers
My dog has been starting to grow this weird fuzzy white fur on her legs. I will be taking her to the grooming and hair cut salon
satela [25.4K]
I would not take here to the groom take her to the vet if you think it is serious but in other case cut some off your self I guess hope this helps:]]]
4 0
3 years ago
Read 2 more answers
If you are in an emergency and there is no space to the side to steer out of the way of a crash, __________.
lana66690 [7]

The correct answer is controlled braking.

If someone suddenly pulls out in front of the person while driving, the natural reaction is to apply the brakes. Although, this is a good reaction if there is the adequate distance to stop and one applies the brakes accurately.

While in case of emergency stops, one should apply brakes in a way, which will maintain the vehicle in a straight line and permits one to turn if it becomes essential. For this, the person can use stab braking method of controlled braking.

In controlled braking, one applies the brakes as hard as one can without locking the wheels. There is a need to keep steering wheel movements very slight while attempting this. If one needs to make bigger steering amendments or if the wheels lock, release the brakes.


8 0
3 years ago
The biome immediately south of the Taiga is the ______.
tino4ka555 [31]

Answer:

tundra

Explanation:

8 0
2 years ago
Other questions:
  • 20) One difference between carbohydrates and lipids is that A) Lipids will dissolve in water but not carbohydrates. B) Carbohydr
    6·1 answer
  • 1. Which elements are most abundant in living organisms?
    14·2 answers
  • Two phenotypically tall heterozygous pea plants are crossed to one another. A phenotypically tall F1 progeny plant is randomly c
    7·1 answer
  • What would happen to a plant if it was put under a green light?
    10·2 answers
  • What are found in the space surrounding the nucleus of an atom
    11·1 answer
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • What does the word autotroph mean? Self food Self nourishment Other nourishment<br>PLZZ HELP!!​
    8·2 answers
  • What is an example of a positive form of thigmotropism?
    15·1 answer
  • Describe two primary functions of the cell membrane.
    12·1 answer
  • Its about the solar system
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!