1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
expeople1 [14]
4 years ago
6

Which cell organelles function resembles the function of the brain in higher animals

Biology
1 answer:
Assoli18 [71]4 years ago
4 0
The functions of the NUCLEUS in the cell resembles the functions of the brain in higher animals. This is because, it is the nucleus that direct all the cell activities and it also contains the genetic material in form of DNA. 
You might be interested in
9
IRISSAK [1]

Explanation:

d.incinerators are to reducing

7 0
3 years ago
Read 2 more answers
Why would a diverse community be more resistant to disease, predation, and invasion
xenn [34]
A diverse community would be more resistant because firstly, the different animals can build immunity to the other animals diseases and sometimes only certain species will be effected by a certain disease. Instead of everything being wiped out, only a small part of the community will.

Hope this helped!
8 0
4 years ago
Which of the following is a homogeneous mixture?
diamong [38]

Explanation:

Blood

hope it helps!

......

6 0
3 years ago
Read 2 more answers
Which of the following does NOT affect earth’s season
irina [24]

Answer:

which of the following???????

5 0
3 years ago
Read 2 more answers
Which best describes emerging scientific ideas?
8090 [49]
If it says describe you need to say three points about the source
4 0
3 years ago
Other questions:
  • Claim Evidence Reasoning. Evaluate the following claim: Meiosis is different than Mitosis.
    11·1 answer
  • Although all of the cells of a plant contain the same genetic material, root cells and leaf cells are not identical because they
    12·1 answer
  • Help.. Psychological drug dependence means that
    10·1 answer
  • True or false questions. grade nine science exam.
    6·1 answer
  • What can Courtney change in her experiment to find the true impact of
    8·2 answers
  • &lt;&lt; Needed ASAP &gt;&gt;<br> What type of air mass is when cold air sinks?
    13·1 answer
  • On the diagram - label ALL the nitrogen bases not
    10·1 answer
  • transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
    7·1 answer
  • PLEASE ANSWER THIS QUESTION ASAP!
    13·1 answer
  • A control can be best defined as:
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!