River water contains minerals and nutrients that can be beneficial to plants on the land, helping them to grow.
Complete Question
Ruben Ward has been weight lifting and eating a high protein diet. Below is Ruben's profile and what he ate for a day. He entered his profile information and food intake into Diet & Wellness Plus and then pulled the Diet & Wellness Plus Reports. View Ruben’s Intake vs Goals and Macronutrient Ranges Reports and then answer the questions below. Profile for Ruben Ward 1. Age: 19 years old 2. Gender: Male 3. Height: 5 ft, 8 inches 4. Weight: 205 lbs 5. Non-Smoker 6. Activity Level: Active
Ruben has recently taken up weight lifting, and his friends at the gym mistakenly believe they should eat more protein to build muscle. The DRI for protein for healthy adults is 0.8 g per kg body weight. If Ruben weighs 205 lbs (93 kg), how many grams protein per kg body weight did he eat on this day?
a. 5.37 g/kg
b. 10.33 g/kg
c. 3.55 g/kg
d. 4.88 g/kg
Answer:
c. 3.55g/kg
Explanation:
RDI means Recommended Dietary intake. It is the required amount of a nutrient expected to be taken by an individual for optimal health.
The Recommended Dietary Intake I'd protein falls withing the range of 0.8 grams per kg to 1.8 grams per kg
For Reuben
He weighs 93 kg
If Reuben consumed 330 grams of protein, his grams of protein per kg body weight is
330 grams ÷ 93kg
= 3.55g/kg.
U can eat anything when ur hungry !!!
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
Answer:
Once a vital plant that many humans or animals need go extinct, many of them will die due to starvation and or shelters they build might not be able to be built due to the extinct plant being gone. As an example, If trees went extinct, humans wouldn't be able to live. One, because trees help filter the air for us humans to breath, wood is a very vital supply too. Wood is used for paper, homes, and even appliances.
Explanation:
