1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nat2105 [25]
3 years ago
11

Is there any explanation of a genetic explanation for substance abuse disorders?

Biology
1 answer:
White raven [17]3 years ago
8 0
Not a specific genetic sequence, some doctors and scientists believe it could be hereditary and others do not believe it is genetic but instead develops due to psychological and environmental factors. Look up the rat park study.
You might be interested in
Giving free points away! If you have over 50 please don’t answer to get the points! Thanks!
rodikova [14]

Answer:

Thanks!

Explanation:

6 0
3 years ago
Read 2 more answers
Which of these statements best explains why space exploration should continue in the future?
Lady_Fox [76]
The correct answer is c.
5 0
3 years ago
Can somebody help me out with this question because I’m really confused??
topjm [15]

It’s a it starts to kick

3 0
3 years ago
An airplane was moving 1200 km per minute
sp2606 [1]

Answer: Its velocity was 20 km/s southward.

Hope this helps!!

5 0
4 years ago
Read 2 more answers
Name 2 places on earth we find carbon
uysha [10]
Here are a couple of answers you can use are... <span>Plants,<span>Diamonds,<span>Charcoal,<span>Graphite,<span>Petroleum Products, and <span>Plastics. all of those carbon can be found in</span></span></span></span></span></span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • Which example is the best description of an adaptation?
    14·1 answer
  • All the statements about extrinsic motivation is not true EXCEPT
    14·1 answer
  • How does a birds beak help you identify its habitat
    13·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • 1. Predict Two photographers take time-lapse
    14·1 answer
  • An elongating ribosome is bound to appropriate tRNAs in both the A and P sites and is ready for peptidyl transfer. What happens
    14·1 answer
  • "An oxygen-rich environment would cause a mass extinction of prokaryotes."
    6·1 answer
  • Which of the following is a part of the male gamete formation, but not in female gamete formation?
    9·2 answers
  • What organelles can be found in a prokaryotic cell? Pls answer ASP.
    11·1 answer
  • The amount of blood ejected from the ventricle in a single contraction is called
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!