1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tamaranim1 [39]
3 years ago
6

I don't even understand this...

Biology
1 answer:
Amiraneli [1.4K]3 years ago
7 0

Answer:

The answer is D

Explanation:

The north pacific usually brings a cool breeze, the north atlantic is usually warmer than the pacific.

You might be interested in
SOMEONE PLEASE HELP MEEE
Jlenok [28]

Answer:

pollution is the introduction of harmfull material in the invironment called pollution

3 0
3 years ago
(05.08 MC)
creativ13 [48]
Answer:
Its iii
Explanation:

7 0
1 year ago
Describe the difference between a gene and an allele?
Lyrx [107]

Answer:

A gene is a section in the chromosome or DNA and the alleles is the sequence.

Explanation:

The gene determines a specific trait. An allele represents the different  variations and alternatives that could be passed on.

8 0
3 years ago
What are the two types of photoreceptors
Burka [1]

There are two types of photoreceptors in the human retina, rods and cones.

8 0
3 years ago
Read 2 more answers
Facts about cellulose (multiple choice)
bixtya [17]

Answer:

a maybe correct me if im wrong

6 0
3 years ago
Other questions:
  • 10. How many protons are in an element with an atomic number of 6 and a mass number of 12?
    9·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Which of the following is a testable hypothesis
    11·1 answer
  • The concentration of potassium is higher in red
    7·1 answer
  • The largest amount of groundwater is used for _______.
    12·1 answer
  • Will makr first answewr brainalist
    6·1 answer
  • Why (DNA) that i distracted from the strawberry doesn't look like double helix
    5·1 answer
  • 2. In fruit flies, an X-linked recessive mutation, scalloped (d), causes irregular wings borders. Use a Punnett square to determ
    6·1 answer
  • How meiosis affects chromosome number
    8·1 answer
  • What is the condition called where a proximal portion of the stomach pushes through an opening in the diaphragm, allowing stomac
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!