1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liberstina [14]
3 years ago
10

From your knowledge about the distribution of electrons in the levels and from the atomic number (in parentheses), indicate the

most likely charge on the ion when this atom forms an ion. (Remember the 2, 8, 18 level distribution.)
Oxygen (8)
Biology
2 answers:
rjkz [21]3 years ago
5 0
Oxygen forms an ion with the charge (-2)
olganol [36]3 years ago
4 0
It will hold -2 charge to be more stable due to completely filled 2p sublevel
You might be interested in
What are extensions of the plasma membrane that serve primarily to increase a cell's surface area called?
muminat

Answer:

Answer is microvilli.

Explanation:

Plasma membrane possesses or comprises of channels , made up of proteins , and form openings for certain molecules to diffuse through and into the cell.

The major function of the microvilli is that it increases the surface area of the cell. This activity increases the rate of absorption, secretion and cellular adhesion.

It should  be noted that, microvilli are projections or protrusions found on the  cellular membrane.

4 0
3 years ago
The cause of the phases of the moon is a cycle that is close to how long
AnnZ [28]

Answer:

The lunar phases gradually change over the period of a synodic month (about 29.53 days), as the orbital positions of the Moon around Earth and of Earth around the Sun shift. The Moon's rotation is tidally locked by Earth's gravity; therefore, most of the same lunar side always faces Earth.

Explanation:

7 0
3 years ago
if a starch-digesting enzyme were added to a sports gel that lists starch as an ingredient which substance would increase in con
vladimir2022 [97]

That execution outside of the cell in which it is produced is Enzymes it degrade large molecules into units that are little enough to be pass through across the cell membrane and into the cell where they can be very useful. 

5 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
A cell's digestive enzymes are closed in a membrane-bound organelle. How can these molecules function in the cell?
leva [86]
<span>The membrane bound organelle you refer to is the Lysosome. The lysosome fuses with a vacuole where it digests the contents. </span>
6 0
3 years ago
Other questions:
  • What are the muscles attached to these bones aid in breathing?
    10·1 answer
  • Interphase, Description of what happens
    6·2 answers
  • True or False, only animal cells contain DNA.
    7·1 answer
  • What are the different types of mass movement? List and Explain/Describe each
    8·1 answer
  • What is part of the third step in troubleshooting a computer problem?
    5·2 answers
  • Depolarization of a membrane can be induced by ________. Group of answer choices increasing its membrane's permeability to Na de
    11·2 answers
  • What animals were impacted by the disappearance of the grey wolf?
    5·2 answers
  • An ideal frictionless machine: O has very little friction O has no friction does not require work input PLEASE HELPP MEEE ​
    9·2 answers
  • Which of the following goals is the U.S. Integrated Ocean Observing System (OOS) not intended to address?
    5·2 answers
  • What condition does the endocrine system works to produce
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!