1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katrin2010 [14]
3 years ago
10

How many people are in the world?

Biology
2 answers:
natima [27]3 years ago
8 0

Answer:

Explanation:7.7 billion (2019)

aleksandr82 [10.1K]3 years ago
6 0
Approximately more than seven billion
You might be interested in
The carbon cycle is critical to________<br> as it is part of _____
Dima020 [189]

Answer:

I'll take a look at your question

Explanation:

The Carbon Cycle is important to the life and development of Trees and Plants as a whole.

We breathe in Oxygen that is provided from the Trees that provide that provide it.

We exhale Co2 ((Carbon Dioxide)) for the Trees to breathe in. This entire cycle and process ensures that we survive as a planet.

As it is an essential part of life

3 0
3 years ago
A new drug has been created by altering dna. what process has been utilized to create this drug?
Rama09 [41]

The process of genetic engineering has been utilized to create this drug.

Genetic engineering is the artificial modification of DNA or other nucleic acid molecules in order to alter an organism’s characteristics in a certain way using biotechnology. Genetic engineering is used by scientists to improve or change the genetic makeup of an individual organism and it involves the transfer of genes to create ameliorate organisms.

6 0
3 years ago
The argument that each individual member of a species transforms itself to meet the challenges of a changed environment through
svlad2 [7]

Answer:

Jean Baptiste de Lamarck

Explanation:

i found this online

8 0
3 years ago
In an analysis of the nucleotide composition of DNA, which of the following proportions will be found?
katrin [286]

Answer:

With respect to the composition of DNA, in an analysis it can be found that the proportions of nucleotides are A + C = G + T (option a).

Explanation:

The proportion of nucleotides in a DNA molecule can be established according to the sequence of these nucleotides on both complementary strands, since the purinic bases of one strand are complemented by the pyrimidinic bases of another:

  • <em>Adenine is complemented with Thymine A=T</em>
  • <em>Guanine is complemented with Cytosine G=C</em>

From this we can deduce that in a DNA molecule with two chains there will be the same amount of adenine and thymine, as well as the same number of guanine with respect to cytosine, so:

<em>     A + C = G + T</em>

An example of this would be a known DNA molecule (hypothetical), with 5 molecules of Adenine and 7 molecules of Guanine. In this case there are 5 Thymines, complementary with Adenine, and 7 Cytosines like Guanine:

<em>     A + C = G + T</em>

<em>     5 + 7 = 7 + 5</em>

6 0
3 years ago
The SI uses the kilogram for mass instead of the gram.
ziro4ka [17]
First question=true
second=false
third=false
6 0
3 years ago
Other questions:
  • How much of the Earth’s water is usable as a freshwater resource?
    15·1 answer
  • Please help!!! I would really appreciate it
    11·1 answer
  • What vessel returns filtered blood to the inferior vena cava
    9·1 answer
  • What is the pathway oxygen/ carbon dioxide take into and out of the body?
    7·1 answer
  • Besides plants what 2 other types of organisms experience plasmolysis
    10·1 answer
  • What best describes the nature of cellular respiration?
    8·1 answer
  • A special dry warm wind that blows from the rocky mountains down into the valleys below is called a
    5·1 answer
  • What does your body do with the heat released during cellular respiration?
    13·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Identify the reactant(s) in the chemical reaction, CO2 + H2O → H2CO3.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!