1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irakobra [83]
3 years ago
10

Please help me with this!

Biology
1 answer:
Molodets [167]3 years ago
5 0

Answer:a geonyphiic dg inside dogs

Explanation:dogs has geolyphic things

You might be interested in
For each molecule of glucose consumed, how many times does the Krebs cycle occur?
bagirrra123 [75]
For each molecule of glucose consumed, the Krebs cycle occurs: D. twice
1 glucose --> 2 pyruvate, each one entering the Krebs as acetyl-CoA
3 0
3 years ago
Read 2 more answers
Substance that accelerates any chemicl reaction but is not consumed in the action
DerKrebs [107]
The answer is enzyme.
6 0
3 years ago
1. En una investigación sobre el ADN de una especie animal se ha encontrado que del total de bases nitrogenadas un 30% correspon
pshichka [43]

Answer:

Adenina (30%), citosina (15%), guanina (15%) o timina (40%)

Explicación:

El 30% de las bases nitrogenadas totales lo ocupa la adenina, el 15% de las bases nitrogenadas totales corresponde a la citosina, el 15% de las bases nitrogenadas totales toma la guanina y el 40% restante de las bases nitrogenadas totales lo ocupa la timina. Entonces, al combinar todos estos porcentajes, obtenemos el 100 por ciento del volumen del ácido desoxirribonucleico (ADN).

5 0
3 years ago
Climate and weather (see image)
NikAS [45]

Answer:Latitude and ocean currents

4 0
2 years ago
Read 2 more answers
In which situation would new technology be most likely to cause a change in an existing theory about new structures a cell?
marysya [2.9K]

The new technology allows detection of a structure that could not be detected previously. Thus, the correct option is D.

<h3>What are the benefits of technology?</h3>

Sales will probably improve as a result of technology that makes it simpler for people to buy from you, including an e-commerce solution and numerous payment apps. Marketing departments are forced to adapt the social media platforms that your clients and potential customers use since they are born and die on a monthly basis.

The tasks that HR departments perform for hiring, reviewing applicants, onboarding, and training involve a significant amount of technology. The more HR duties you can complete using technology, the quicker they can be completed and the less likely it is that you will make a mistake that could result in a lost recruit, an employee leaving, or a lawsuit. Employee education on topics like benefit enrollment and corporate policies, for instance, guarantees appropriate paperwork is done and cuts down on training time for new hires.

For more information regarding technology, visit:

brainly.com/question/7788080

#SPJ1

7 0
2 years ago
Read 2 more answers
Other questions:
  • The process by which two species, for example, a flower and a pollinating insect, evolve in response to each other is called ___
    6·1 answer
  • What would your body be like if you did not have any bones
    15·2 answers
  • Which statement best describes the social status of women in ancient Egypt? Women were viewed as the lowest social class. Women
    7·2 answers
  • Suppose a restriction enzyme recognizes the six-base sequence aagctt ttcgaa in a double strand of dna . Between which two nucleo
    14·1 answer
  • 9. Your boss at Wendy's says you will receive a raise if you sell over 60% of the fries that are in the cooler. There are 230 po
    13·1 answer
  • Write the following as an algebraic<br> expression:<br> the product of 5 and b<br> What
    12·1 answer
  • A volcanic eruption covers a wide area of forest with Ash lava and volcanic rock.
    13·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • A chromosome has an inversion.which describes a pericentric inversion
    9·1 answer
  • How does water depth affect marine life
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!