1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Hitman42 [59]
3 years ago
9

A popular pesticide used in both world wars was what

Biology
1 answer:
marin [14]3 years ago
3 0
DDT, or dichlorodiphenyltrichloroethane
You might be interested in
What are the five kinds of relationships organisms in an eco system can have with each other?
Arte-miy333 [17]
Predation,competition,mutualism,commensalism, amensalism these are the five relationship organisms have with each other
6 0
3 years ago
Aquatic organisms in coastal areas face a variety of predators on land and in the water and air. Which ocean process exposes the
PSYCHO15rus [73]

Answer:

b

Explanation:

<em>The correct answer as to the ocean process that exposes the coastal organisms to land-based predators would be the daily tidal patterns that leave the coastal area exposed to the land for a part of the day.</em>

Some parts of the coastal areas become exposed to land during certain periods of the day as a result of tidal waves. When this happens, the aquatic organisms occupying these coastal areas become temporarily exposed to land predators who hunt and kill them for food.

<u>Therefore, the correct option is b. </u>

7 0
4 years ago
A star is a large celestial body that is composed of very cold hydrogen gas and emits light.
snow_tiger [21]
False
A star is a large celestial body, but it is composed of very hot hydrogen gas.
6 0
3 years ago
Read 2 more answers
6. Applying Concepts Liza rode her bike to the
aleksandr82 [10.1K]

Answer:

Liza bought things that had little packaging. She practised conservation through this as the less packaged items would not have been sold and hence would have gone to waste.

Liza did not use a plastic bag to put her bought items. Instead, she used her backpack. In this way, she practised conservation by not using a plastic bag. Also, plastic bags are hard to dispose of and are not degradable.

3 0
3 years ago
How dose crossing over benefit the organism
trapecia [35]
Hope this helps


A benefit of crossing over is that it maintains genetic diversity within a population, allowing for millions of different genetic combinations to be passed from parents to offspring. Genetic variability is very important to the long-term survival of a species
6 0
3 years ago
Other questions:
  • A water molecule is lost when two glucose units come together to form a molecule of lactose which type of reaction is involved i
    11·1 answer
  • What might happen if the magma under a mid ocean ridge cools?
    13·1 answer
  • This Nitrogen is not in a useable form. Plants and animals can not simply absorb nitrogen from the atmosphere. Therefore, it mus
    11·1 answer
  • What relationship exists between nutrients and biomolecules?
    5·2 answers
  • Which of the following best describes the term parasitism?
    9·2 answers
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Lactose is a disaccharide formed by the formation of a ________ bond between glucose and ________.
    14·1 answer
  • Write the part of the brain that performs each of the functions shown below. (2 points)
    7·2 answers
  • What inherited change in genetic informational
    9·1 answer
  • Your friend nods back and forth to you, making the "yes" motion. What muscles are involved in this ‘yes’ motion? Select all that
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!