1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex_Xolod [135]
4 years ago
14

What is cytokinesis?

Biology
2 answers:
HACTEHA [7]4 years ago
5 0
Cytokinesis is the process during cell division in which the cytoplasm of a single eukaryotic cell is divided to form two daughter cells
Mama L [17]4 years ago
5 0
Cytokinesis<span> is the process by which two cells split after cell division, or mitosis. The process is different between animal and plant cells. Mitosis</span>
You might be interested in
_____ recognized the vital role of the internal environment and suggested that the objective of mechanisms within the body is to
VikaD [51]
Carolus Linnaeus recognized the vital role of the internal environment and suggested that objective of mechanisms within the body is to preserve the constant conditions of the internal environment.
He was later known as the creator of current modern system of naming animals called binomial nomenclature 

hope this helps
5 0
3 years ago
Explain the difference between renewable and nonrenewable resources and give an example of each.
Lelu [443]

Answer:

Nonrenewable Resources take longer to be replenished, reneweable resources are easily replenished and easily accessible.

Explanation:

If something is Nonrenewable; for example fossil fuels like coal, oil, and natural gas, then that means that the organic matter is limited and not going to grow or be created easily on Earth.

Renewable Resources are usually classified into five categories; Hydro, Solar, Wind, Biomass, and Geothermal. All of these resources are easily accesible and can be used as a natural energy source.

Hope this helped :)

6 0
3 years ago
"in humans, the ability to roll the tongue is a dominant trait; the inability to roll the tongue is a recessive trait."if two in
erastovalidia [21]
There is a 0 percent chance 
6 0
4 years ago
What are the primary types of geological activity that occur at plate boundaries ? Choose the best two answers from the list bel
Montano1993 [528]

Answer:

Earthquakes and Volcano activity

Explanation:

........................

6 0
3 years ago
An oligomeric enzyme transitions from a T to R state as substrate binds, producing positive cooperativity. If a heterotropic all
V125BC [204]

Answer:

Increase

Explanation:

Oligomeric enzyme have more than one polypeptide chain and the enzyme show positive cooperativity. It means that binding of the ligand to the enzyme will help other ligands to bind to the enzyme. Hill cofficient is used to measure the determining the degree of cooperativity of the binding between enzyme and substrate or ligand. As in this case, allosteric enzyme show positive cooperativity, its Hill cofficient will increase

6 0
4 years ago
Other questions:
  • What is gel electrophoresis not used for
    12·2 answers
  • What does glycolysis start and end with?
    13·1 answer
  • The movement of hot and cold air between land and sea creates what? a. Sea breeze b. Solar energy c. Trade winds d. Coriolis eff
    10·1 answer
  • Identify the primary role of the lymphatic system? a) Delivery of oxygen to the deep muscle cells b) Produce and store large num
    12·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Helps activate T cells, which are produced in bone marrow but mature in the thymus gland<br> HELLPP
    14·1 answer
  • Bored. Is Anyone else?? Lol
    8·1 answer
  • In what ways do humans affect the different trophic levels in ecosystems on Earth?
    10·2 answers
  • HELP FAST PLZ TAKJNG A TEST !!!!!! Will give Brainly and 30 points !!
    7·2 answers
  • Between Mars and Jupiter is a region
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!