1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olganol [36]
3 years ago
7

The starches and sugars found in grains, vegetables, legumes, and fruits are

Biology
2 answers:
Andrews [41]3 years ago
4 0
The answer: A. carbohydrates
kramer3 years ago
3 0

It's carbohydrates. Have a great day! :)

You might be interested in
What are 3 ways that compounds and mixtures differ
professor190 [17]

Answer:

3 ways to understand the differences between compounds and mixtures are described below in explanation.

Explanation:

1. In a mixture, no new product is formed. It is a simple tacking of two molecules without any chemical reaction occurring. For example water and sand. Compound is a new substance formed by chemical reactions occurring between various molecules. For example, carbon and oxygen combine to form carbon dioxide.

2. A compound is always homogeneous whereas a mixture can be homogeneous or heterogeneous.

3. Compounds have a fixed boiling and melting temperature. Whereas, mixtures do not have a definite melting and boiling temperature.

5 0
3 years ago
What’s the difference between heal cells and human cells?
Vesnalui [34]

Answer:

HeLa cells, like many tumours, have error-filled genomes, with one or more copies of many chromosomes: a normal cell contains 46 chromosomes whereas HeLa cells contain 76 to 80 (ref) total chromosomes, some of which are heavily mutated (22-25), per cell.

Explanation:

3 0
4 years ago
[OU.01] Radio waves are primarily used to
Flauer [41]
When converted to a household measurement, 9 kilograms is approximately equal to a
6 0
2 years ago
What term refers to loose DNA inside the Nucleus?
erik [133]
Chromatin is my answer if I was right can I get brain please

6 0
3 years ago
Why is it more accurate to compare the average height gain of the control and experimental groups (instead of comparing individu
torisob [31]

Answer:

It is better to compare the average height gain of control and experimental groups of plants to eliminate all other variables.

Explanation:

If you evaluate individual plants, the data may vary. The experimental group is the one where an experimental procedure is performed while the control group does not receive any treatment.

4 0
3 years ago
Other questions:
  • True or faulse organic fat will not dissolve in water
    8·2 answers
  • Atoms have three subatomic particles: protons, neutrons, and electrons. ... Knowing what you know about the nucleus and the suba
    8·2 answers
  • Cycles of four chemicals essential to life on earth: water, carbon, nitrogen and phosphorus. be sure to use appropriate key term
    9·1 answer
  • Help me please , A , B , C OR D
    13·1 answer
  • During what phase is the chromosomes number reduced from 2n to n?
    13·1 answer
  • Why does ice float on liquid water
    10·2 answers
  • Dalam upaya mengurangi pencemaran lingkungan, masyarakat diharapkan berperilaku ramah lingkungan dengan menerapkan gerakan 3R. J
    13·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • How are igneous rocks formed?
    5·2 answers
  • How does gene flow directly contribute to evolution? I'll mark brainliest
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!