1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rasek [7]
3 years ago
7

Visit the website below and use the information to answer the question that follows. On the About Forensic DNA tab, read the sec

tions titled “About Forensic DNA” and “Basics of DNA Typing.” DNA Evidence Basics How can DNA be used to help solve a crime?
Biology
2 answers:
oee [108]3 years ago
7 0
Each person’s DNA is unique.Scientists use variable regions in DNA to create  DNA profile.<span>DNA samples can be taken from blood, bone, hair, or other body tissues and
products.</span>DNA from a crime scene can be compared to DNA from a suspect.DNA typing can be used to solve old cases.  this is what you need to write.

Naddika [18.5K]3 years ago
3 0

Answer:

Each person’s DNA is unique.Scientists use variable regions in DNA to create  DNA profile.DNA samples can be taken from blood, bone, hair, or other body tissues and

products.DNA from a crime scene can be compared to DNA from a suspect.DNA typing can be used to solve old cases.  this is what you need to write.

Just took the test

You might be interested in
List at least four factors that
lord [1]

Answer:

Differences in temperature or precipitation determine the types of plants that grow in a given area (Figure 1). Generally speaking, height, density, and species diversity decreases from warm, wet climates to cool, dry climates. Raunkiaer (1934) classified plant life forms based on traits that varied with climate.

Explanation:

5 0
2 years ago
Describe how the process of photosynthesis led to an increase in cellular respiration and more complex cells
koban [17]

Answer:

<u><em>BRIEF EXPLANATION</em></u>

Photosynthesis is the anabolic process of building up glucose and making O2 from CO2 and water while cellular respiration is the opposite catabolic process of breaking down glucose by oxidizing it with O2 to get CO2 and water.

Explanation:

<em><u>MAIN ANSWER TO THE QUESTION.</u></em>

Photosynthesis is like when you’re trying to gain muscle and you eat tuna and eggs to turn it into muscle tissue. This takes energy in the form of food just like how photosynthesis requires sunlight for energy.

Cellular respiration is like when impoverished people starve for a week because they don’t have sufficient food to eat for nutrients. They have to get them from somewhere else. So the body breaks down glycogen, body fat and muscle tissue to provide the energy.

3 0
2 years ago
For every action or force in nature there is an equal and opposite reaction
Inessa05 [86]

Answer:

This is true.

Explanation:

6 0
3 years ago
During meiosis chromosomes will split into daughter cells randomly this is called
Monica [59]

Answer:

Cell division

Explanation: Meosis is the result of an egg and sperm coming together to form a zygote, before the zygote becomes an actual zygote, it goes through cell divison to create the daughter cell w

5 0
2 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • What is significant about areas in the dna that contain repeated segments?
    14·1 answer
  • A relationship between a consumer and producer
    10·2 answers
  • Please help me with this question?!!!!!
    13·2 answers
  • When did the ocean become an important area of study?
    9·2 answers
  • How do chlorofluorocarbons contribute to the hole in the ozone layer
    15·1 answer
  • Since this is an answer for a short paragraph help me..
    15·2 answers
  • Plzzz....someone ....Diffusion
    12·1 answer
  • A large number species on Earth become extinct during a short time period about 65 million years ago. Based on this pattern of e
    9·1 answer
  • Look at the equation for cellular respiration and write in which stage of the process each molecule is either used or produced.
    6·1 answer
  • Pleaseeeee helpppppp me I need this done now
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!