1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dezoksy [38]
3 years ago
6

Explain the phenomenon of photorespiration, why it is thought to occur (evolutionarily speaking), and why plants have evolved to

minimize its occurrence.
Biology
1 answer:
Ghella [55]3 years ago
4 0
Photorespiration or oxidative photosynthetic carbon cycle or C2 photosynthesis is a process in which enzyme RuBisCO oxygenates RuBP that leads to wastage of some energy formed during photosynthesis. This process involves three organelles chloroplast, peroxisomes and mitochondria.

Photorespiration occurs in dry and hot climatic plants when there is more oxygen in atmosphere than carbon dioxide. It is a light dependent process where glycolate is synthesized.

The plants have minimized its occurrence because it is a wasteful process. In photosynthesis carbon dioxide is used while in photorespiration carbon dioxide is releases. Thus, these processes work against each other so the plants minimize its occurrence.
You might be interested in
Which of the following changes is most likely to happen if the process
Jobisdone [24]

Answer:

<em>C. Increased loss of soil nutrients</em>

Explanation:

7 0
3 years ago
While studying several generations of a particular family, a geneticist observed that a certain disease was found equally in mal
alisha [4.7K]

Answer:

I sara ei you cool cumbia 11

8 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Use the diagram below to answer the question.
kramer

ummm what ????

do

you

mean

confuson

also

stonks

6 0
3 years ago
You are on the scene in the bad part of town for an unresponsive 18-year-old type 1 diabetic patient. his mother states that he
Margaret [11]
<span>The answer would be: Continue patient care by getting a complete SAMPLE history and perform a complete secondary assessment.

If the reading of glucose test is normal, then you can exclude hypoglycemia from the possible diagnosis. Because the patient is accompanied by his mother, you can ask a brief history to exclude other possible diagnosis and complete secondary assessment before further help comes. The information would be beneficial to the healthcare personnel that will comes for help.
</span>
8 0
3 years ago
Other questions:
  • Bulimic nervosa is foremost __________? an excessive like of food an excessive appetite an excessive dislike of food none of the
    6·1 answer
  • Which of the following describes why wetlands are important to the water cycle?
    9·2 answers
  • Asthma narrows airways to the lungs and in the lungs by contraction of muscles around the air passages, swelling of the airway l
    8·2 answers
  • What is an inflammatory disease of the arteries with clot formation, usually in the legs, leading to occlusion of arteries and i
    9·1 answer
  • Why should people care about invasive species?
    15·1 answer
  • Which of these qualities is common to cancer cells? a. They continue to grow even when surrounded by other cells. b. Their produ
    11·1 answer
  • Saturated fats have long straight tails of fatty acids, while unsaturated fats from vegetables have kinks in their tails due to
    9·1 answer
  • Plzz help will give brainiest. What pair of chromosomes do not go through crossover
    12·2 answers
  • What can you leam about soil and air from looking at your graphs and your answers above?
    10·1 answer
  • According to the theory of evolution by natural selection, which of these statements is correct?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!