1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kaheart [24]
3 years ago
11

If all green plants in the world were distroyed which atmospheric gas will increase

Biology
1 answer:
Mila [183]3 years ago
8 0

 Trees are a crucial part of the<span> carbon cycle</span>, a global process in which carbon dioxide constantly circulates through the atmosphere into organism and back again. Carbon is the second most valuable element to life, you know, after water. Anyway, trees take carbon from the atmosphere through <span>photosynthesis </span>in order to make energy. This carbon is then either transferred into oxygen and released into the air by <span>respiration </span>or is stored inside the trees until they decompose into the soil. Therefore, the absence of trees would result in significantly HIGHER amounts of carbon dioxide in the air and LOWER amounts of oxygen! The filthy air would also be full of airborne particles andpollutants like carbon monoxide, sulfur dioxide and nitrogen dioxide and its temperature may increase by up to 12 F.


You might be interested in
What is the volume in milliliters of 0.23 kg of pure water
Citrus2011 [14]

230 is your anwser! sorry bad english

5 0
3 years ago
True or False? Please mark "True" if the entire statement is true or mark "False" if any part of the statement is false. You can
dalvyx [7]

Answer:

True. You can get vitamin A as "preformed vitamin A" which is already active and/or you can get vitamin A as carotenoids which the body can turn into active vitamin A.

Explanation:

There are two different types of vitamin A that can be obtained from food:

1.  Preformed vitamin A, which is already active, is found in animal products such as beef, fish, poultry and dairy products.

2. Provitamin A, which is the inactive form, is found in plant-based foods, such as fruits and vegetables. The most common type of provitamin A is β-carotene, which is a carotenoid that the body can turn into active vitamin A via an enzyme named β-carotene 15,15'-monooxygenase.

6 0
3 years ago
Which cell structure is made of a bilayer of phospholipids and<br> encloses all cells?
wlad13 [49]

Answer:

The cell structure is the plasma membrane also known as the cell membrane.

Explanation:

The plasma membrane is the thin coat of lipids (phospholipids) that surrounds and encloses a cell, also can be called the cell membrane

4 0
3 years ago
Alexis knows that different forms of water can affect erosion differently. She wants to build a model to compare different forms
Natasha_Volkova [10]

Answer:

1. Obtain two identical containers and dry sand.

2. Shape equal amounts of sand into a  "slope on the side of"  each container.

3. Spray water on the sand in one container. The sprayed water represents "rainfall" .

4. In the other container,  "place ice cubes to melt on the sand. This represents snow or glaciers." .

5. Observe and record the changes in the sand.

6. Analyze differences between the two containers.

Explanation:

Mine hasn't been graded yet but I'm pretty sure this is the right answer. I'll come back once it's graded and say.

8 0
3 years ago
Which of the following would not be included in a description of an organism's niche? a. its trophic level b. its color c. the h
IRISSAK [1]

Answer:

C

Explanation:

This is because niche talks about tje role of an organism.

Considering the humidity of the organism is not given a role to the organism.

7 0
3 years ago
Other questions:
  • All cell membranes are primarily composed of _____________.
    14·2 answers
  • The bed alarm is ringing because an older adult client is attempting to get out of bed. a nurse enters the room and finds the cl
    14·1 answer
  • If all cells in a human come from one zygote (fertilized egg cell), with the same genetic information (genome), how does special
    10·1 answer
  • What term is defined as the tendency of some members of a population to be better able to survive and reproduce and pass on thei
    6·1 answer
  • Living systems must maintain their chemical and physical organizations in order to prevent death. how do living organisms mainta
    11·2 answers
  • Which of the following is an autotrop
    5·1 answer
  • Select three sports that require participants to be highly fit before the beginning
    10·2 answers
  • Protein molecule are long, usually folded chains made from 20 different kinds of amino-acid molecules. Amino acid molecules are
    6·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • All of the amino acids found in protein are derived from which metabolic pathway?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!