1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
finlep [7]
4 years ago
13

What two substances are produced by green plants during photosynthesis?

Biology
1 answer:
MrMuchimi4 years ago
4 0
Glucose (sugar) and oxygen are produced.
You might be interested in
Why are photosynthesis and cellular respiration viewed as complementary processes?
asambeis [7]

Cellular respiration and photosynthesis are complementary processes because they use each others' products and reactants.


Photosynthesis' products are cell respiration's reactants; likewise, cell respiration's products are photosynthesis' reactants.


Also, photosynthesis is known to take away carbon dioxide from the air and put in oxygen while cellular respiration does the opposite, putting in carbon dioxide while taking away oxygen.

6 0
3 years ago
Which would make the best pioneer species during primary succession?.
oksian1 [2.3K]

Answer:

mosses or lichens, algae fungi

this organisms are knows as pioneer species because they are the first species present.

6 0
3 years ago
HELP IT DUE NOW !!!!!!!!!!!!!!!
Ira Lisetskai [31]
Perennial Shrubs I know it is late.
6 0
3 years ago
Which of these statements is not true of the nucleolus? which of these statements is not true of the nucleolus? it contains fibr
Ugo [173]
Nucleolus is not connected to the nucleus via nuclear pores.
<span>Nuclear pores are protein complexes that cross double membrane of the nucleus and allow the transport of molecules across the nuclear envelope (double membrane): from the nucleus to the cytoplasm (RNA and ribosomal proteins) and into the nucleus (proteins, carbohydrates, signalling molecules and lipids).</span>
6 0
3 years ago
Read 2 more answers
This male fiddler crab is waving his claws to attract a female. what type of behavior is this? question 29 options: defense surv
Andreas93 [3]

This male fiddler crab is waving his claws to attract a female, This is inherited, Option D. This is further explained below.

<h3>What is an inheritance?</h3>

Generally, inheritance is simply defined as the transmission of genetic traits from parents to children.

In conclusion, The female attraction technique is an inherited attribute,

Read more about Reproduction

brainly.com/question/23471979

#SPJ4

7 0
3 years ago
Other questions:
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Genetic engineering has the potential to correct
    13·2 answers
  • Differentiation of organisms and their differences ???
    14·1 answer
  • List the layers of the sun's interior and atmosphere, starting from the center.
    8·1 answer
  • What is it biotechnology?<br> What is it artificial selection? What it is clone?
    11·1 answer
  • a heterozygous chicken with black feathers mates with a white chicken whats the possiblility the offspring will be black
    5·1 answer
  • ¿Que factores del medio ambiente afectan los tegidos de los seres vivos?​
    9·1 answer
  • This term is used to describe different variations of a gene
    9·1 answer
  • What is happening to the [OH-] when the solution turns from pink to violet?
    13·1 answer
  • According to the principle of causal determinism, everything that will happen in the future is the consequence of what has happe
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!