1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
emmainna [20.7K]
3 years ago
14

A biology student hiking in a forest happens upon an erect, 15-centimeter-tall plant that bears microphylls and a strobilus at i

ts tallest point. when disturbed, the cone emits a dense cloud of brownish dust. a pocket magnifying glass reveals the dust to be composed of tiny spheres of 2 different sizes.
Biology
1 answer:
Naily [24]3 years ago
3 0
<span>lycophyte sporophyte</span>
You might be interested in
Which of the following does not contribute to water pollution?
igomit [66]

Answer: d none of the above

Explanation:

:)

6 0
3 years ago
Read 2 more answers
____________ is a form of undernutrition caused by an extremely deficient intake of calories, protein, or both. two examples of
Irina-Kira [14]
Protein-energy malnutrition is a form of undernutrition caused by an extremely deficient intake of calories, protein, or both. Two examples of this type of malnutrition are kwashiokor and marasmus. Protein-energy malnutrition is more often caused by decreased absorption or abnormal metabolism. It  is defined as a range of pathological conditions arising from coincident lack of protein and/or energy in varying proportions. The condition vary in forms ranging from mild through moderate to severe degrees. 
4 0
4 years ago
In one sentence, summarize what resting metabolic rate is.
Vikki [24]
Resting metabolic rate is the rate in which your body burns energy to function while at rest.
7 0
3 years ago
Dodos were flightless birds that have been extinct for about 300 years. Imagine that biologists found two surviving dodos and ma
ad-work [718]

Answer:

Dodos were flightless birds that have been extinct for about 300 years. Imagine that biologists found two surviving dodos and mated this pair of birds. What would you expect of the resulting dodo population after three generations?

The maximum number of alleles present for any gene in the new population is two

Explanation:

As a result of this mating, in the third generation the maximum number of alleles present for any gene in the new population will be two.

7 0
3 years ago
What do you call an organism that lives in or on another organism and feeds on that other organism
goldfiish [28.3K]
The host. have a good day!!
7 0
4 years ago
Other questions:
  • BRAINLIESTTT ASAP!!!<br> :)
    11·2 answers
  • Distinguish between eukaryotic and prokaryotic binary fission.
    14·1 answer
  • The following equation shows the correct molecules formed in the reaction, but the products are incorrect. CH4 +2O2 → H2O + CO2
    6·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Clean energy sources have minimal impact on the environment and come from what resources
    5·1 answer
  • Which of the following would NOT characterize allopatric selection?
    14·1 answer
  • Hello I need help!!! did I get this right ​
    10·2 answers
  • Label the Phases of meiosis
    15·1 answer
  • What do you call a forested wetland in wet season, that typically remains waterlogged at all times. Has trees*
    5·2 answers
  • Scientists have observed that in the Antarctic ecosystem Adélie and Chinstrap penguin populations have decreased in the past 40
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!