1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
algol13
2 years ago
10

A person that is heterozygous type AB (AB) marries a person that is heterozygous type A (AO). What is the probability that their

potential offspring will be type A?
A. 0%

B. 25%

C. 50%

D. 75%

E. 100%
Biology
1 answer:
BigorU [14]2 years ago
6 0

Answer:

The correct option is <em>B. 25 %</em>

Explanation:

 A heterozygous type can be described as the type in which both the alleles of a gene are different. If both the alleles of a gene are similar in an organism, then the person is said to be homozygous for the trait.

In the above question, two heterozygous parents are to be cross- bred to check the probability of them producing homozygous alleles (AA).

A punnet square made will show the following results:

       A     O

A     AA    AO

B    BA     BO

Hence, there will be 25% chance that the offspring produced could be homozygous AA.

You might be interested in
Which of the following can occur in a polar cell
Solnce55 [7]

Phospholipid can occur in a polar cell.

You can put the options for your accurate answers in comment box...

3 0
2 years ago
You memorize a series of numbers by grouping them into sets of three and thinking of these sets as area codes. This is an exampl
RSB [31]

Answer:

The correct answer is chunking.

Explanation:

Chunking is a term signifying the procedure of taking single pieces of information or chunks and aligning them into bigger units. By aligning each piece into a large whole, one can better the amount of data one can remember.  

Generally, the most common illustration of chunking takes place in phone numbers. By distinguishing dissimilar single elements into bigger blocks, information becomes easier to recall and retain.  

8 0
2 years ago
Your aunt grows sprouts hydroponically. from where do her plants get nutrients?
larisa [96]
Hydroponics way of growing, is way of farming, in which plants are grown in nutrient rich water. So, in Hydroponic growing of sprouts, sprouts get their nutrients from the nutrients supply like liquid fertilizers which are mixed with the water. It is one of the advantage of hydroponic means of growing because, unlike in soil system, the plants root does not have to work hard to get nutrient from underground. The easy availability of nutrients and other condition like water, pH level etc makes plants grow faster are fuller.

Also, advancement of technology have made it possible to prepare built-in hybrid hydroponic system which have multiple ways of delivering nutrient to specific plants. 
8 0
2 years ago
Not all members of a species are the same. Every species exhibits variations . , like eye color, are passed from parent to offsp
Klio2033 [76]
Inheritance!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

7 0
3 years ago
Examples of short-term, human-induced environmental changes
Drupady [299]
Pollution and deforestation
7 0
2 years ago
Other questions:
  • Which hormone has the most influence on a safe pregnancy?
    6·2 answers
  • What is Education and biology​
    6·1 answer
  • What is the difference between the ligamentum arteriosum and the ductus arteriosus?
    6·1 answer
  • 7. As plants like corn made their way
    9·1 answer
  • Which word means "the history of life in the geological past as indicated by the imprints or remains of living things"?
    6·1 answer
  • What is a cell called that isn't a sex cell?
    12·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • PLEASE HELP!
    12·2 answers
  • Form a Hypothesis: As the map shows, the sickle cell allele is not found in African populations that are native to southern Afri
    15·1 answer
  • In ancient Greece, Aristotle developed a system of classification which was used for the next 2000 years to describe relationshi
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!