1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GarryVolchara [31]
2 years ago
8

When Sharon purchased her car, she read the car's manual, which included directions on how to change a tire. When she got a flat

a few years later, she was able to change the tire much faster than her friend who hadn't previously read the manual. Sharon was exhibiting:
classical conditioning.
observational learning.
latent learning.
operant conditioning.
Biology
1 answer:
lubasha [3.4K]2 years ago
7 0

From what we know, we can confirm that in the situation described, Sharon was exhibiting latent learning.

<h3>What is latent learning?</h3>

This is described as an ability that one learns, but does not show the use of this knowledge until much later in life. This is a very common occurrence in that one does not put into practice something that they have learned until a situation arises that requires said knowledge to be applied.

Therefore, given that Sharon learned how to change the tire through the manual, but did not exhibit this information until years later, we can confirm that she is exhibiting latent learning.

To learn more about learning visit:

brainly.com/question/6194260?referrer=searchResults

You might be interested in
In which organelle does the DNA replication occur in the cell?
tia_tia [17]
It occurs in the nucleus 
5 0
3 years ago
Read 2 more answers
Changes in the dna sequence that affect the expression of genetic information are called
AVprozaik [17]
This is called mutation my friend
8 0
2 years ago
Read 2 more answers
Give an example, from any biome, of how two types of organisms may interact with each other in the following ways:
garik1379 [7]
A cow will eat grass in a field, the grass is the plant and the plant eater is the cow. (Srry if this is not what your looking for)
4 0
2 years ago
What is plastic texture in the earth's structure?
Allisa [31]
It is called the float
5 0
2 years ago
My question is in the image!!
qaws [65]

C. ADP + P ---> ATP

3 0
1 year ago
Other questions:
  • Please answer this! :) Thank you for whoever answers this for me!
    5·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What do you do when you want to fight someone but don't want to take the consiquence
    15·1 answer
  • What term is given to the actual name of a color?
    7·1 answer
  • VOCABULARY REVIEW Define purine
    15·2 answers
  • What is the main function of the structure that is identified as A in the picture above?
    15·1 answer
  • Which of the following lists the correct symbol for the ion that tin forms when it loses 2 electrons, the correct classification
    15·1 answer
  • Name the cavity between the nose and mouth.
    14·1 answer
  • Antimicrobials that are effective against a wide variety of microbial types are termed _______.
    8·1 answer
  • Explain why it may have been difficult to discover pond water organisms from pond water sample under the microscope comparing to
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!