Answer:
Please give me brainlist
Explanation:
There is a 50 percent chance that daughters carry the gene and can pass it to the next generation. There is a 50 percent chance that a daughter will not carry the gene and, therefore, cannot pass it on. There is a 50 percent chance that sons do not have the gene and will be healthy.
Cell-tissue-organ-organ system-organism
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
Calcium
Explanation:
Parathyroid hormone (PTH) is a hormone that is secreted by the parathyroid gland. It is the major regulator of the plasma concentration of calcium ions. It regulates calcium ions in the kidney, intestine and bones.
In the kidney, is involved in the re-absorption of calcium in distal ducts and the renal collecting duct, it is also involved in activating the conversion of 25-hydroxy vitamin D into 1,25-dihydroxy vitamin D (calcitriol).
In the intestine, PTH is involved in the absorption of calcium, by increasing vitamin D production.
In the bone, it helps in regulating calcium levels; when serum calcium level is low, PTH stimulates the activity of the osteoclast, to produce more calcium.
