1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexdok [17]
3 years ago
12

Plz answer

Biology
1 answer:
rjkz [21]3 years ago
6 0

cchhcchhcchhcchhcchh

You might be interested in
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
4 years ago
What is the greatest cause of muscle atrophy? biology?
schepotkina [342]
It has been known that the greatest cause of muscle atrophy is lack of physical activity, that contributes to your muscle to waste away. This can possibly happen when you accidentally injured yourself or might have a certain disease that makes it for you difficult or to move your body as well. 
4 0
3 years ago
3. Milk of magnesia is a medication used to treat constipation, upset stomach, and
True [87]

Answer: Mg = 194g   O = 294g  H = 16g

Explanation:

8 0
4 years ago
A compound formula is found to contain 31.42% sulfur, 31.25% oxygen, and 37.23% fluorine by mass.
Evgen [1.6K]

Explanation:

the answer is in the image above

3 0
3 years ago
Is it true that all cells are little
noname [10]
Yes, they r very small indeed 

free points haha
5 0
4 years ago
Read 2 more answers
Other questions:
  • Compare and contrast inbreeding and hybridization
    14·1 answer
  • What is the probability that a normal visioned woman who marries a man that is colorblind will have a daughter who is colorblind
    11·1 answer
  • During inhalation, air continues to move into the lungs until:_____
    7·2 answers
  • How could the botanist best determine whether the genotype of the green-pod plant is homozygous or heterozygous?
    8·1 answer
  • Researchers have found his approach helpful for people with depression and perhaps even bipolar disorder, schizophrenia, and cer
    5·1 answer
  • Help me please<br> If you help me you get brainliest answer and 20 points!!!!!!
    6·2 answers
  • A/An _______ forms around a well when the water table begins to slope toward the well.
    13·2 answers
  • These bacteria rapidly divide until they run out of space. Their growth then slows down, and their population size stabilizes. W
    6·1 answer
  • The relationship between the remora is and the shark is an example of
    15·1 answer
  • To investigate a possible relationship between two factors, such as acidity and solubility, you must first identify the variable
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!