1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katovenus [111]
3 years ago
11

3. What eventually stops the spread of the virus in the host?

Biology
2 answers:
WINSTONCH [101]3 years ago
8 0

Answer:

white blood cells

Explanation:

wlad13 [49]3 years ago
8 0
White blood cells !!
You might be interested in
scientists have a great deal of responsibility why is it important for scientists to communicate their results accurately to peo
Art [367]
So other scientists can try the exact same experiment and see if they both got the same results.
5 0
3 years ago
When h forms a bond with h2o what bond is it making ?
Reil [10]

When h forms a bond with h2o to form hydronium ion, h3o , this bond is called a coordinate covalent bond.

4 0
3 years ago
How to lift fingerprints off of porous surfaces ?
VladimirAG [237]

Answer:

by by STAFF AUTHOR, Most people think you can't get prints from a wet surface, but you can if you use Small Particle Reagent (SPR). SPR is like liquid fingerprinting powder and can be used on non-porous surfaces. Spray SPR onto wet evidence then rinse with water.

Explanation:

please mark as brainliest if I helped you

6 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
If there are 4 nitrogen bases and they are read in groups of three, how many codons are possible?
Alex Ar [27]

64 is the answer to this

4 0
3 years ago
Other questions:
  • Identify characteristics of a virus
    10·1 answer
  • How is Bohr's atomic model different from Rutherford’s model?
    11·2 answers
  • What is a simple statement that predicts the result of a controlled scientific experiment? Question 1 options: Observation Hypot
    9·2 answers
  • Which of the following is true about the properties of aqueous solutions?
    5·1 answer
  • Which analogy most accurately defines scientific theory?
    14·1 answer
  • To celebrate her recent weight loss, Lisa’s friends decide to take her out for a healthy dinner. Lisa doesn’t drink alcohol beca
    14·1 answer
  • Which of these genotypes are heterozygous?<br><br> A: TT<br> B: Tt<br> C: tt<br> D: none of these
    6·2 answers
  • The blood type trait is controlled by more than two alleles for a given gene and therefore is called multiple alleles.
    5·2 answers
  • A cell moves particles from a region of lesser concentration to a region of greater
    7·2 answers
  • Which of the following is correct?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!