Explanation:
1. A decrease in the number of greenhouse gases that humans produce will result in lowered global temperatures. This will allow the ice sheets in the polar regions to increase increasing also albedo.
2. Using light-colored building materials on houses and pavement in urban centers will work towards increasing albedo as more sunlight is refelcted back by built environments.
3. Decreased deforestation/increase in aforestation increases the earth’s sirface albedo because vegetation reflects back more sunlight than the earth’s bare surface.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
<em>The correct option is D) immigration</em>
Explanation:
Immigration can be described as the movement of an organism to another place for living. As the scenario in the question tells, the population of the endangered Philippine eagle could be seen only in one place hence we can say that the immigration rate of these organisms was zero because they could not be seen in any other place.
Other option, like option B, cannot be correct because mortality refers to the death rate and obviously many organisms of the species died due to which it became endangered.
I might be incorrect, but from what I remember it should be particle size
