2. The stepper the gradient the more energy the stream has as it flows down.
3.. the higher the gradient, the higher the velocity and the ability to erode and carry sediment . As the gradient decreases toward the coast,stream velocity slows and the ability to transport sediment decreases.
The result of non-reproduction is simple.
There will not be another generation of a species. Without a new generation, the parents would die off, and there would be nothing to carry on the name they had both shared.
Hope this helps! ( °ω° )
Cell stained light for the metaphase test and dark for the SDH, then we can classify the cell as an oxidative cell.
<h3>What is metaphase?</h3>
Metaphase, the second stage of mitosis, sees the chromosomes travel onto the spindle's equatorial plane.
<h3>What is the SDH test?</h3>
- Oxidative cell stains are dark for the SDH test and light for the metaphase test.
- SDH is an enzyme used in testing mainly to detect hepatocellular injury in cattle and horses.
- SDH enzyme is also detected in human tissues. The major sites where the SDH enzymes are found in humans are kidneys, seminal vesicles and kidneys.
To know more about oxidative cells visit:
brainly.com/question/11574154
#SPJ4
Animal behavior researchers often refer to an activity associated with punishment or reward as an operant. The basis for training animals is the operant conditioning. It is a learning process where the animal would learn base from its behavior as it responds to its environment. In this type of learning, the behavior is either increased or decreased by the results that follows the action. It uses rewards and punishments in order to associate with the behavior. For instance, you are trying to teach your dog to fetch an object, if he succeeds in fetching the object, then you give your dog a treat. The dog would think that what it is doing is good and that it would get a reward from it so it would start learning the behavior.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
