1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
antiseptic1488 [7]
3 years ago
7

Studying the folding patterns of protein molecules can help microbiologists better understand cellular processes as well as some

diseases, such as Alzheimer’s, that are caused by proteins that have misfolded. The folding of these complicated molecules can be simulated on computers, but it takes a lot of processor power and time for even expensive supercomputers to do this.
A group of researchers at Stanford University developed software that can be used to distribute the processing of data to anyone who is willing to donate time on their idle personal computers. As a result, the researchers have been able to achieve protein-folding simulations that are far better than those other computing methods have done. Which statement best describes the work of these researchers?
Biology
1 answer:
vivado [14]3 years ago
5 0
The statement that best describes the work of these researchers is "As a result, the researchers have been able to achieve protein-folding simulations that are far better than those other computing methods have done." I hope my answer has come to your help. God bless and have a nice day ahead!
You might be interested in
Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i
Marat540 [252]

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

  • 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

  • Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

  • Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.

  • According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.

  • In RNA, Thymine (T) bases are replaced by Uracil (U).

Learn more in:

brainly.com/question/837295?referrer=searchResults

7 0
2 years ago
What is the correct mRNA transcription of the following DNA sequence? ATGGCACCTTAC A. UACCGUGGAAUG B. CATTCCACGGTA C. AUGGCACCUU
andrew-mc [135]

Explanation:

In a DNA molecule, Adenine forms hydrogen bonds with Thymine and Cytosine forms hydrogen bomds with Guanine.

However in mRNA, Thymine becomes Uracil (T => U)

Therefore every A in the DNA sequence becomes U,

every T in the DNA sequence becomes A,

every C in the DNA sequence becomes G,

every G in the DNA sequence becomes C.

The answer is A.

3 0
2 years ago
Which best describes the antacid’s effect?
qwelly [4]
Antacids that contain magnesium have a laxative effect that may cause diarrhea, and in patients with renal failure they may cause increased magnesium levels in the blood, because of the reduced ability of the kidneys to eliminate magnesium from the body in the urine.

Read more on Brainly.com - brainly.com/question/5214746#readmore
5 0
3 years ago
The process represented by the equation pyruvic acid + NADH-> Alcohol + CO2 + NAD is
sukhopar [10]
This represents the anaerobic part of cellular respiration, this  specifically would represent the Krebs cycle. I highly doubt that they want you to be that specific, so Cellular respiration 
5 0
3 years ago
How is a chemical equation
Ratling [72]

Answer:

Differential equations capture the vectors of thr rate of change, which are found experimentally to be tangent to the configuration space of a system.

Explanation:

5 0
2 years ago
Other questions:
  • Which of the following is not a factor influencing preventive measures used to combat the spread of disease? A. Antibiotics B. C
    14·1 answer
  • Why does a person often get light headed after blowing up a balloon?
    15·1 answer
  • 3.   Unlike New World monkeys, hominines
    9·1 answer
  • Is Osteoporosis an infectious disease or non-infectious?
    10·1 answer
  • Some archaea are polyploid. Which of the following statements are TRUE regarding archaeal polyploidy? Check All That Apply
    7·1 answer
  • Rivers
    13·1 answer
  • Nuclear proteins having a molecular mass more than approximately 40 KDa must be actively imported through nuclear pore complexes
    13·1 answer
  • What is mRNA strand what will pair with CAT and what A.A will it code for
    7·1 answer
  • The process in which rocks are formed, change, and break down is called
    5·1 answer
  • Molecules helped by protein; move insoluble molecules across plasma membrane:
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!