1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
antiseptic1488 [7]
4 years ago
7

Studying the folding patterns of protein molecules can help microbiologists better understand cellular processes as well as some

diseases, such as Alzheimer’s, that are caused by proteins that have misfolded. The folding of these complicated molecules can be simulated on computers, but it takes a lot of processor power and time for even expensive supercomputers to do this.
A group of researchers at Stanford University developed software that can be used to distribute the processing of data to anyone who is willing to donate time on their idle personal computers. As a result, the researchers have been able to achieve protein-folding simulations that are far better than those other computing methods have done. Which statement best describes the work of these researchers?
Biology
1 answer:
vivado [14]4 years ago
5 0
The statement that best describes the work of these researchers is "As a result, the researchers have been able to achieve protein-folding simulations that are far better than those other computing methods have done." I hope my answer has come to your help. God bless and have a nice day ahead!
You might be interested in
Someone plz help with this inquiry skill question. Thank you
vekshin1
You are controlling the variable of if it gets vinegar and less water, or all water because that is all that changes.
4 0
3 years ago
What macromolecules does celery have
VikaD [51]
Carbohydrates is the macromolecule found in celery.
5 0
4 years ago
The movement of fluids between cellular compartments ________. the movement of fluids between cellular compartments ________. is
zlopas [31]
<span>The movement of fluids between cellular compartments is regulated by osmotic and hydrostatic forces.</span>
<span>

Hydrostatic pressure<span> is the force exerted by a fluid against a wall which causes movement of fluid between compartments. This pressure is important for exchanging plasma and nutrients between capillaries and surrounding tissues</span> and also in the nephrons (kidneys) where ensures proper filtering of the blood to form urine.</span> <span>Fluid also moves between compartments along an osmotic gradient (the difference in concentration of solutes on one side of the cell membrane to that on the other side). Water constantly moves into and out of fluid compartments via osmotic gradient.</span>
7 0
4 years ago
¿Por qué la replicación es semidiscontinua, bidireccional y semiconservativa?
Greeley [361]

Answer:

Explanation:fhjkį wqtÿ

3 0
4 years ago
Please help! me with this ASAP!
Genrish500 [490]
Which one is it ? i cant tell
7 0
4 years ago
Other questions:
  • Driving down the road, you hit an insect. How does the force your car exerts on the insect compare to the force the insect exert
    13·1 answer
  • About 1.2 billion years ago, eukaryotic and multicellular organisms evolved because
    10·1 answer
  • In passive absorption, nutrients enter the cell
    7·1 answer
  • What is upwelling and why is it important to the marine ecosystem?
    14·1 answer
  • The following pedigree shows the inheritance of a dominant trait. What is the chance that the offspring of the following matings
    10·1 answer
  • Which is the site of the most ATP production during cellular respiration?
    9·2 answers
  • A bird species in danger of extinction has a population that is decreasing exponentially left parenthesis upper a equals upper a
    9·1 answer
  • Which genetic test would be used on an adult?
    7·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • Will give brainliest and 20 points :)
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!