During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Explanation:
In a DNA molecule, Adenine forms hydrogen bonds with Thymine and Cytosine forms hydrogen bomds with Guanine.
However in mRNA, Thymine becomes Uracil (T => U)
Therefore every A in the DNA sequence becomes U,
every T in the DNA sequence becomes A,
every C in the DNA sequence becomes G,
every G in the DNA sequence becomes C.
The answer is A.
Antacids that contain magnesium have a laxative effect that may cause diarrhea, and in patients with renal failure they may cause increased magnesium levels in the blood, because of the reduced ability of the kidneys to eliminate magnesium from the body in the urine.
Read more on Brainly.com -
brainly.com/question/5214746#readmore
This represents the anaerobic part of cellular respiration, this specifically would represent the Krebs cycle. I highly doubt that they want you to be that specific, so Cellular respiration
Answer:
Differential equations capture the vectors of thr rate of change, which are found experimentally to be tangent to the configuration space of a system.
Explanation: