1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bazaltina [42]
3 years ago
11

Bryophytes are also called ___plants.

Biology
2 answers:
Nezavi [6.7K]3 years ago
6 0
<span>Bryophyte is a traditional name used to refer to all embryophytes that are non-vascular plants, namely the mosses, hornworts, and liverworts.</span>
gulaghasi [49]3 years ago
6 0

Answer;

-Amphibian plants

Explanation;

Amphibians are those organisms which live on both land and in water. Bryophytes are called amphibians of the plant kingdom because these plants though live in soil but they need water for sexual reproduction.

Bryophytes are small, non-vascular plants, such as mosses, liverworts and hornworts. They play a vital role in regulating ecosystems because they provide an important buffer system for other plants, which live alongside and benefit from the water and nutrients that bryophytes collect.

You might be interested in
If your lac operon looked like the image below, which of the following can you infer?
Marysya12 [62]

Answer:

You have not consumed lactose from dairy recently

Explanation:

According to the diagram, there is a represssor element in the regulatory region of the operon. This repressor is blocking the RNA polymerase, that is bound to its promoter region upstream of the genes, from transcription. The repressor is mostly the lac repressor that switches of the operon in the absence of lactose.

3 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
To keep the humeral head centered within the glenoidal cavity the rotator cuff muscles must be __________. Select to launch anim
enyata [817]

Answer:

<h2> located in the same plane</h2>

Explanation:

  • Such types of muscles and tendons that play an important role in the stabilization of the shoulder are called rotator cuff muscle.
  • These muscles are responsible for the different types of motion and simply called a different range of motion.
  • Muscles like scapulohumeral muscles,  infraspinatus muscle and some others are grouped as rotator muscle.
  • These muscles are involved in the movement of the shoulder and also stabilize the joints of the shoulder for the movement and during the movement.
  • When the humeral head is centered within the cavity of the glenoidal then the rotator cuff muscle should be on the same plane.
8 0
3 years ago
What is menopause, and why does it occur?
katovenus [111]

Answer:

A woman is born with all of her eggs, which are stored in her ovaries. The ovaries also make the hormones estrogen and progesterone, which control her period (menstruation) and the release of eggs (ovulation). Menopause happens when the ovaries no longer release an egg every month and menstruation stops.

5 0
3 years ago
Read 2 more answers
Please help me?? I need help labeling the graph using the word bank
sladkih [1.3K]

Answer:

Explanation:

  1. Oceanic Plate
  2. Subduction Zone
  3. Convection Currents
  4. Asthenosphere
  5. Continental Plate

The Oceanic Plate is located near the ocean ridge. Which represents where magma creates new oceanic crust.

The Subduction Zone is where the tectonic plates meet.  These are called plate boundaries.  

Convection Currents are what drives the movement of rigid tectonic plates in Earth's molten mantle.

The Asthenosphere is the upper layer of the mantle. Which is below the lithosphere (Continental Plates).  

Continental Plates are the outer shell of the mantle.

Let me know if this helps!

7 0
2 years ago
Other questions:
  • Match the gastric phase on the left (1-3) with the correct description on the right (4-6): 1. intestinal phase 4. prepares stoma
    13·1 answer
  • Which statement describes elements?
    13·1 answer
  • How does the Corolla effect impact ocean currents in the northern and southern hemisphere
    5·2 answers
  • NADPH is produced in the light independent reaction.<br> a. True<br> b. False
    7·1 answer
  • Less than 0.1% of the energy in a food chain generally makes it from the sun to quaternary consumers. Please select the best ans
    15·1 answer
  • Which of the following is an example of a species changing over time?
    12·1 answer
  • Can you guys pls help
    5·1 answer
  • What is the official term for "water jet" in a squid
    7·1 answer
  • What are thermohaline currents?
    11·1 answer
  • I have a question lol I can't sleep
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!