1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
deff fn [24]
3 years ago
8

Robert Paine studied sea stars in the intertidal zone along the northern Pacific coast. When he removed sea stars from a study a

rea, their prey, two mussel species, increased exponentially. This crowded out other species, and the overall biodiversity of the community was greatly reduced. What role in the community did the sea star play?
Biology
1 answer:
Sergeu [11.5K]3 years ago
7 0
<h2>Sea star  </h2>

Explanation:

In the given example sea star played the role of keystone species

  • Robert Paine actually coined the term keystone species to describe the effect that the sea stars had on biodiversity in this community
  • Keystone species are those species which are least abundant but play a governing role to decide the structure and function of community
  • Loss of keystone species in a community can lead to disturbance in structure and function of a community and it cannot be recovered by other species  

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Analyze the graph with a partner. How many mass extinctions did you identify? How did you determine when they occurred?
Scilla [17]

Answer:

4 mass extinctions

Explanation:

as there are huge drops in the graphs

at 440,390,260,50

Mark me as brainliest pls

6 0
3 years ago
What are the smallest blood cells in the frog?
Tamiku [17]

Answer:

Unlike typical mammalian red blood cells, those from amphibians, such as frogs, contain a DNA-bearing nucleus that is visible in the center of the cell. The circulatory system of amphibians is rather unusual, their hearts having three chambers, two atria, and a single ventricle.

NegativePositive

Positive

The design of the amphibian circulatory system is curious because blood accumulates oxygen in the lungs and is then returned to the heart before being pumped into the rest of the circulatory system. Therefore, a mixing between oxygenated and deoxygenated blood occurs as blood returning to the heart from the lungs is mixed with incoming blood from the body. Frogs handle this situation by having a very slow metabolism and by absorbing some oxygen through their skin. In addition, the ventricle does have some directional control over the distribution of the blood.

Negative

The presence of a nucleus in amphibian red blood cells allows researchers easy access to large quantities of amphibian DNA. Frog blood has both a solid and a liquid portion. The liquid plasma carries solid elements such as red and white blood cells. Blood can be collected from frogs and the red blood cells isolated by centrifugation. After removal of the residual plasma, purified cells can be treated with specific enzymes and detergents to digest the cellular envelope and release DNA from its protein complex. The DNA is then useful for scientific studies and experiments.

Featured in: Phase Contrast

Explanation:

4 0
3 years ago
Which side of the Pacific and Atlantic Oceans is colder at 40°N?<br> A. western<br> B. eastern
mash [69]

Answer:

A. western

Explanation:

Is the Atlantic Ocean warmer than the Pacific Ocean? Answer: Although it might seem illogical, the Atlantic Ocean is warmer. For any given latitude, the Atlantic Ocean has proved to be about 16 degrees F (9 degrees C) warmer than the Pacific Ocean off the U.S. coast – quite a difference.

3 0
3 years ago
In certain mice, long tails (T) are dominant over short tails (t). If 2 hybrid mice mate, what will the outcome be?
yuradex [85]

Answer:

3 long tails : 1 short tail

Explanation:

This question involves a single gene coding for tail length in mice. The allele for long tail (T) is dominant over the allele for short tail (t). This means that an heterozygous mice will possess the long tail length.

According to this question, in a cross between two hybrid or heterozygote mice i.e. Tt × Tt, the following gametes will be produced by each parent:

Tt - T and t

Using these gametes in a punnet square (see attached image), the following will be produced: TT, Tt, Tt and tt.

Offsprings with genotype TT, Tt and Tt will have a LONG TAIL while genotype  tt will have a SHORT TAIL. Hence, the phenotypic ratio will be 3 long tails : 1 short tail.

7 0
3 years ago
Other questions:
  • Of the following options, which is the largest level of classification? A. Order B. Family C. Species D. Genus
    7·2 answers
  • Explain how your dna compare for your traits
    14·1 answer
  • Many bivalves, like scallops, live in salt water. The scallop captures food particles from water that flows over its gills. Whic
    10·2 answers
  • Which of these is a statement of opinion?
    5·1 answer
  • A labradoodle is a cross between?
    7·2 answers
  • How is ATP formed from ADP
    5·1 answer
  • Lanes of young stars gas and dust that wind outward from the central region of spiral galaxies can be identified as
    13·2 answers
  • What makes up the "tail" of an ATP molecule?
    8·2 answers
  • What are ocean waves caused by? What affects how large they are?
    12·1 answer
  • !! NEED DONE SOON!!
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!