Answer:
They are thick, strong and made up of thousands of tubulin which are spiral in shape.
Explanation:
In eukaryotic cells, they have microtubules which are fibres serving as tracks for cell to cell transport and regulate the shape of a cell.
Microtubules are different from other cytoskeletal filaments because they possesses a cylindrical shape with the tube having a larger diameter of 20-25 nm as compared to microfilament that have a diameter of 3-6 nm.
Microtubules are made of subunits of proteins called tubulin named alpha and beta that is not present in other cytoskeletal filaments.
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer: 2. Precipitation
Explanation:
Aerobic cellular respiration requores oxygen. Photosynthesis does, as well.
Nucleotides. They are the building blocks of DNA.
Answer:
skynesher / Getty Images. The dependent variable is the variable that is being measured or tested in an experiment. For example, in a study looking at how tutoring impacts test scores, the dependent variable would be the participants' test scores, since that is what is being measured.
Explanation:
Hope this helps, If it did, then I would really appreciate it if you gave me Brainliest, I only need one more to rank up and it has taken forever to get to where I am currently. Thanks.