1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mrac [35]
2 years ago
10

During inspiration, after leaving the larynx, air enters the __________.

Biology
1 answer:
Alex2 years ago
8 0
<span>During inspiration, after leaving the larynx, air enters the trachea.</span>
You might be interested in
Cilia are composed of microtubules. How are microtubules different from the other cytoskeletal filaments?
Maru [420]

Answer:

They are thick, strong and made up of thousands of tubulin which are spiral in shape.

Explanation:

In eukaryotic cells, they have microtubules which are fibres serving as tracks for cell to cell transport and regulate the shape of a cell.

Microtubules are different from other cytoskeletal filaments because they possesses a cylindrical shape with the tube having a larger diameter of 20-25 nm as compared to microfilament that have a diameter of 3-6 nm.

Microtubules are made of subunits of proteins called tubulin named alpha and beta that is not present in other cytoskeletal filaments.

4 0
3 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
2 years ago
Which of the following is NOT a part of the oxygen cycle?
Svet_ta [14]

Answer: 2. Precipitation

Explanation:

Aerobic cellular respiration requores oxygen. Photosynthesis does, as well.

4 0
2 years ago
Read 2 more answers
The small units that make up the macromolecule DNA are called
Leokris [45]
Nucleotides. They are the building blocks of DNA.
7 0
3 years ago
What is a test variable? Give an example.
Sphinxa [80]

Answer:

skynesher / Getty Images. The dependent variable is the variable that is being measured or tested in an experiment. For example, in a study looking at how tutoring impacts test scores, the dependent variable would be the participants' test scores, since that is what is being measured.

Explanation:

Hope this helps, If it did, then I would really appreciate it if you gave me Brainliest, I only need one more to rank up and it has taken forever to get to where I am currently. Thanks.

6 0
2 years ago
Read 2 more answers
Other questions:
  • A patient with a head injury that is resulting in edema (swelling) of the brain is given an intravenous solution that contains m
    5·1 answer
  • 6. Which of these BEST describes our current understanding about how species evolve over time?
    11·2 answers
  • In mice, the allele for black fur is dominant to the allele for brown fur. a male homozygous black mouse is crossed with a femal
    6·1 answer
  • What resources can we use for a tornado?
    7·1 answer
  • In small quantities, alcohol can be mistaken for a stimulant because it: a. stimulates the sympathetic nervous system b. speeds
    11·1 answer
  • Number the steps of the binary fission process in the correct order
    14·1 answer
  • Cómo influye el proceso de la mitosis y meiosis en tu crecimiento y desarrollo<br>​
    14·1 answer
  • ____ carrier moves solute through a membrane up its concentration gradient, uses ATP molecule.
    9·2 answers
  • If 2 blood vessels had the same resistance while Blood Vessel 1 has a difference in
    5·1 answer
  • Please help me <br><br> Which day had the highest relative humidity ?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!