1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Margaret [11]
3 years ago
11

Reproduction of plants differs from reproduction of animals in that _____.

Biology
1 answer:
antiseptic1488 [7]3 years ago
5 0

plants have a distinct, multicellular haploid phase

You might be interested in
What would happen if a new cell does not contain chromosomes ( best answer with explantion will get brainliest)
Mademuasel [1]

a. the new cell will not have instructions on how to function

Because all the genetic material is stored in the chromosomes. Thus, all information is in it.

5 0
3 years ago
Read 2 more answers
If one abiotic factor changed drastically, what effect would that have on the ecosystem?
evablogger [386]

if a plant is adapted to low temperatures and the specific are where it lives, has a change in its temperature this plant will die and this area will no longer support life, which is due to the change in abiotic factor

5 0
3 years ago
A protein has been used by comparative molecular biologist to show the evolutionary path of how organisms did what things in reg
Anit [1.1K]

Answer:

Cytochrome C; it provides evidences that there is similarities in the respiratory pathways for producing ATPs by  all living organisms especially mammals.

Explanation:

Cytochrome c is located in the intermembranes of mitochondria, and it functions in the transfer of  of one electron in electron transport chain,(ETC) needed for  generation of proton motive force;  for generation of energy in the synthesis of ATPs by ATPase synthase  during chemiosmosis. Its allows oxdation-reduction by the switching of its iron ii to iron iii. during electron transports.However its iron atoms does not undergo oxidation with  oxygen. This feature makes it stable and  an ideal carrier of electrons.

Its amino acid sequences is very similar in all living organisms especially  between mammals(e.g man and chimpanzees)with little variation in few amino acid residues due to mutation.This similarity in its amino acids sequences in all  living  organism together with small molecular size makes it ideal  molecular evidence  for studying comparative molecular evidence of  evolution.

This is because it can be used  to trace  the pathways of respiration to synthesize energy, and therefore to conclude that  most  organisms share common ancestry, since a very similar protein sequence in  a structure(Cytochrome c) participated in unique ETC mechanisms  in all, needed for energy synthesis .

5 0
3 years ago
Who first recognized the cell universal unit of life
stealth61 [152]

Robert Hooke.

Hope this helps!

5 0
3 years ago
Read 2 more answers
What happens to the speed of light as it exits the air and enters a glass of water?
neonofarm [45]

Answer:

I believe its D

Explanation:

because why would it slow down or speed up

5 0
3 years ago
Other questions:
  • Before protein becomes an energy source, the _________ must be removed from the molecule.
    12·1 answer
  • Choose a plant or animal that you think is interesting. describe some of the threats or challenges
    6·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Bipedalism's advantages over quadrupedalism include
    13·1 answer
  • Answer me fast please
    7·2 answers
  • What is the importance of codons differing in the last nitrogenous base (ex. CUU, CUC both coding for leucine) but still being a
    10·1 answer
  • How do plants get the nitrogen they need?
    10·2 answers
  • What would have eventually
    14·1 answer
  • The carrying capacity of an ecosystem is the maximum number of individuals of a certain species the ecosystem can support. Carry
    13·1 answer
  • Channel between the middle ear and the nasopharynx.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!