1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VMariaS [17]
3 years ago
9

Why is it so important for your body to maintain water or sugar homeostasis

Biology
2 answers:
DochEvi [55]3 years ago
7 0
You’ll die if u don’t
eimsori [14]3 years ago
5 0
Two important aspects of homeostasis are balancing the blood sugar levels and maintaining the body temperature. Your body is made up of millions of cells which need the conditions inside your body to be as constant as possible so they can work properly.
You might be interested in
You are trying to match DNA found at a crime scene with two possible suspects. Why would it be a better use of your time and res
Sunny_sXe [5.5K]

Answer: A double restriction digest

Explanation: A double restriction digest is a process were two restriction enzymes are used to digest DNA in a single reaction.in double restriction digest you will observe two bands,while in single restriction digest you will observe just one band. In double restriction digest no

Self - ligating plasmid because it create mismatch ends. It also aids in directional in section while single disgestion you have to screen your clones to be sure to get your plasmid with correct insert orientation.

7 0
3 years ago
Which of the following terms refer to the total number of different species, including humans, on Earth or in an area? (Choose a
lorasvet [3.4K]

Answer:

biodiversity

Explanation:

3 0
3 years ago
Which atom is involved in giving your heart energy to beat?
zhannawk [14.2K]

The answer is oxygen

6 0
3 years ago
Read 2 more answers
Red Algae belong to which phylum of Protists?
Sedaia [141]
D CHLOROPHYAT  NOT THE OTHER ONES  
3 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Why don't antibiotic work on viruses?
    13·1 answer
  • By using different types of technology, like weather satellites, radar, and river gauges, scientists can reduce flood damage and
    11·1 answer
  • The final electron acceptor in aerobic respiration is
    5·2 answers
  • What is a adjective for quarterback
    11·1 answer
  • What are sunspots? Pls help
    11·1 answer
  • Organism's traits depend on the____in its cells.
    11·1 answer
  • A group of researchers discovered the fossilized remains of a flying mammal that appears to have lived 130 million to 165 millio
    14·1 answer
  • Why are epithelial cells in membranes
    14·1 answer
  • Which of the following are true regarding ores?
    12·1 answer
  • what potentially negative consequences might some biofuels have that prevent them from being a total replacement for fossil fuel
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!