1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
UkoKoshka [18]
3 years ago
9

plant cells contain another organelle that functions as a storage tank for excess glucose or starch what is it

Biology
1 answer:
Sholpan [36]3 years ago
3 0
Vacuoles are the storage tank for the cell.
You might be interested in
The mass extinctions that occurred 250 million years ago and 65 million years ago may have been due to gradual processes or ____
dusya [7]

The mass extinctions that occurred 250 million years ago and 65 million years ago may have been due to gradual process or Catastrophic events.

6 0
3 years ago
Read 2 more answers
Define autotrophs, heterotrophs, producers, and photoautotrophs.
sergey [27]
Producers: living things that make their own food through a process called photosynthesis

Autotrophs: an organism that is able to form nutritional organic substances from simple inorganic substances such as carbon dioxide.

Heterotrophs: an organism deriving its nutritional requirements from complex organic substances.

Photo autotrophs: organisms that carry out photosynthesis. Using energy from sunlight, carbon dioxide and water are converted into organic materials to be used in cellular functions such as biosynthesis and respiration.
3 0
3 years ago
The process of mitosis is the same in plant and animal cells until the division of the cytoplasm. At this stage, plant cells dev
VARVARA [1.3K]
I think it’s D vacuoles, I’m not certain but it don’t hurt to try if it’s not that try A
4 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
BRAINLIESTTTT ASAP!!!
Irina-Kira [14]
Cellular respiration in algae, as in all organisms, is the process by which food molecules are metabolized to obtain chemical energy for the cell. During the process of photosynthesis, cells use carbon dioxide and energy from the Sun to make sugar molecules and oxygen. These sugar molecules are the basis for more complex molecules made by the photosynthetic cell, such as glucose.<span>
I hope this helps!!!
(Please put as Brainliest answer if you can!!)</span>
7 0
3 years ago
Other questions:
  • Chain of hemoglobin is 1 m.u. from the albino locus. assume for the moment that the same is true in humans. the disease sickle-c
    7·1 answer
  • Hey friends pls help here!!<br>to which species the orangutan belongs??​
    11·1 answer
  • When a plant opens and closes its stomata, it is maintaining _____.
    7·1 answer
  • Natural selection is a _____ of evolution
    11·1 answer
  • Which of the following statements about the import of protein to the nucleus is correct? Choose all that apply. a. An NLS can be
    14·1 answer
  • A ratio used as a scale on a map is called a?
    12·1 answer
  • Plz help it due today
    15·1 answer
  • Can you please check my answer? I'm not sure that I did this right. I had to use google docs to make it.
    8·1 answer
  • What allow animals to perform their functions
    6·1 answer
  • Which is an example of using a mathematical model to describe the atom?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!