1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sladkih [1.3K]
3 years ago
8

25 lb greater or less than 384 oz

Mathematics
1 answer:
NeTakaya3 years ago
7 0
25 lbs would be greater than 384 oz because 384 divided by 16 (because 16 oz per lb) =24lbs
so 25lbs > 384 oz
You might be interested in
Helpp me please
garik1379 [7]

Answer:

4. D

5. B

6. B

Step-by-step explanation:

Flowcharts are used to show the steps of a process in a subsequential order. They are not used to represent relations or functions therefore the answer is D

In a function each x value had its own corresponding y value. To be more specific the x value cannot repeat.

In answer choice A the x value 3 and -3 repeats therefore is is not a function

in answer choice b each x value has it's own y value. So this might be the answer but just to be safe let's check the other

In answer choice C the x value 2 repeats multiple times therefore it is not a function

In answer choice D the x value 4 repeats therefore it is not a function

So we can conclude that the answer is B

The dependent variable is the variable the depends on another variable to get it's value. in the description of the question it says that the number of products on his plastic bag lists INFLUENCES how many plastic bags he brings to the store.This means that the number of plastic bags depends on the number of products on the plastic bags lists. Hence the answer is B

6 0
3 years ago
Express ln 32 - ln 8 as a single natural logarithm
ivanzaharov [21]
\bf \textit{Logarithm of rationals}
\\\\
log_a\left(  \frac{x}{y}\right)\implies log_a(x)-log_a(y)\\\\
-------------------------------\\\\
ln(32)-ln(8)\implies ln\left( \frac{32}{8} \right)\implies ln(4)
8 0
3 years ago
Read 2 more answers
Riley bought snacks for her team's practice. She bought a bag of popcorn for $2.75 and a 8-pack of juice bottles. The total cost
DENIUS [597]

Answer:

2.01

Step-by-step explanation:

Assume x is cost of each bottle of juice.

2.75 + 8x = 18.83

8x = 18.83 - 2.75

8x= 16.08

x= 16.08 ÷ 8

x= 2.01

7 0
3 years ago
What number Multiplied by 0.5, Multiplied by 3, Square the number, Add 1 equals 50?​
kkurt [141]

Answer:

Step-by-step explanation:

first step: 0.5 * x

second step: 3* (0.5x) = 1.5x

third step: (1.5x)^2

fourth step: (1.5x)^2 + 1 = 50

(1.5x)^2 + 1 = 50                    Subtract 1 from both sides

(1.5x)^2 = 49                          Take the square root of both sides

1.5x = sqrt(49)

1.5x = +/- 7

1.5x = +7

x = 7/1.5

x = 4.67

1.5x = - 7

x = - 7 / 1.5

x = - 4.67

7 0
3 years ago
The marked price of a watch is 30% above the cost price. When it is sold allowing
Yanka [14]

Answer:

The marked price =  Rs 4,475.

Step-by-step explanation:

Let the marked price of the watch = x

Let the cost price of the watch = y

The given information are;

The marked price of the watch = 30% above the cost price

The discount when it was sold = 20%

The gain when it was sold = Rs 150

Therefore, we have marked price = y + 30/100×y = y + 0.3·y = 1.3·y

The selling price with 20% discount is therefore, 1.3·y - 0.2×1.3·y

The selling price = 1.04·y

The gain = Selling price - cost price = 1.04·y - y = 0.04·y

Rs 150= 0.04·y

y = Rs 150/0.04 = Rs 3,750

Therefore, the marked price = 1.3×y = 1.3×3,750 = Rs 4,875

The marked price =  Rs 4,475.

5 0
4 years ago
Other questions:
  • Toilet rolls come in packs of 4 and 9. The 4 pack is priced arbitrary £2.04 the 9 pack is priced at £4.68 by calculating the pri
    7·2 answers
  • 582 people used the public swimming pool. The daily prices are $1.50 for children and $2.00 for adults. The receipts for admissi
    7·1 answer
  • A researcher collated data on Americans’ leisure time activities. She found the mean number of hours spent watching television e
    15·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • 3+2x=17 I’m taking a test
    5·2 answers
  • Im giving away points if u guess my 4 phobias
    8·2 answers
  • Which of the following expressions is equivalent to −56−13? Select all that apply. A. (−56)⋅(−3) B. (−65)⋅(−3) C. (−65)⋅(−13) D.
    11·1 answer
  • In AWXY, WY is extended through point Y to point Z, mZYWX = (20 + 12)",
    11·1 answer
  • Unit 11: volume and surface Area homework 3: area of composite figures
    10·1 answer
  • A scale drawing of a house is 2:9. If the length of the actual kitchen is 18 feet, how long was it in the drawing?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!