1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zloy xaker [14]
2 years ago
7

What is the structure of amino acids?

Biology
1 answer:
zheka24 [161]2 years ago
5 0

Answer:

Ch plus = O

Explanation:

You might be interested in
What part of a hair is most likely to yield useful dna evidence?
polet [3.4K]
Probably the hair inside the follicle. It hasn’t reached the outside environment to slowly die.
5 0
3 years ago
What theory was Huygens writing about?
sashaice [31]
Huygens was writing about the theory of light.
5 0
3 years ago
What are the main constituents of the jovian planets?.
alexira [117]

Answer:

Unlike the terrestrial planets that make up our inner solar system — Mercury, Venus, Earth, and Mars — the Jovian planets do not have solid surfaces. Instead, they are composed primarily of hydrogen and helium, with traces of methane, ammonia, water, and other gases in their atmospheres.

I think it will help you.

8 0
2 years ago
Why do malleable and ductile physical properties help make minerals useful? Pls answer with a simple/easy to understand answer
vodomira [7]

Answer:

Malleable and ductile properties indeed help minerals useful. Both properties are useful because they help in transforming the shapes of minerals. Malleability is a useful property since it can be flattened or pounded by a hammer. Also, the ductile property makes it possible for the minerals to be stretched in the form of a wire. These two properties makes it useful for minerals.

Explanation:

Malleable and ductile properties indeed help minerals useful.

Both properties help in transforming the shapes of minerals.

Malleability is a useful property since it can be flattened or pounded by a hammer.

The ductile property makes it possible for the minerals to be stretched in the form of a wire.

7 0
2 years ago
How were humans formed?
liq [111]

Answer:

Through the process of evolution

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • How do you think the nervous, epithelial, connective, and muscle tissues in your stomach work together in the process of digesti
    12·1 answer
  • Which of the following is the correct order of organizations of structures in living things from simplest to most complex?
    12·2 answers
  • What quantity is equal between two solutions that are isotonic ?
    11·1 answer
  • Proteins are an essential component of a healthy diet for humans (and other animals). their most common purpose is to serve as:
    12·1 answer
  • What is energy?
    14·1 answer
  • Why is circular doubled stranded DNA the preferred
    14·1 answer
  • Describe a consequence of overpopulation of deer in the forest areas of the northeastern United States.
    13·2 answers
  • Which of the following statements is false?
    9·1 answer
  • To enter or leave a cell substance must be through
    15·2 answers
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!