1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vova2212 [387]
3 years ago
15

23,697 round to the nearest ten thousand

Mathematics
1 answer:
CaHeK987 [17]3 years ago
8 0
20,000 would be the answer
You might be interested in
If the club is sending 3 members to a convention, how many different groups of 3 members are possible?
Natasha2012 [34]
There are 120 different possible groups.
(10 * 9 * 8)/(3 * 2 * 1) + 120
6 0
3 years ago
A building has 63 apartments and 70 bathrooms. What is the ratio of apartments to bathrooms in the building?
valina [46]

Answer:

63:70

Step-by-step explanation:

8 0
3 years ago
ILL BRAINLIEST YOU IF YOU GET IT RIGHT<br><br> please explanation
Anastaziya [24]

Answer:

I thinks

Step-by-step explanation:

8 0
2 years ago
At the end of the month mr copley has $1473.61 in is checking account his checkbook showed the following transaction if made mad
ycow [4]

Total balance in Mr. Copley at the end of the month = $1473.61.

Initial deposite =  $75 (not shown in his checkbook).

Let us assume his balance at the beginning of the month = x.

Total balance at the end of the month = The balance at the beginning of the month + total deposite.

$1473.61 = x + 75.

Subtracting 75 from both sides, we get

1473.61 -75 = x + 75 -75.

1398.61 = x.

Therefore, his balance at the beginning of the month was $1398.61.

7 0
3 years ago
(03.01 LC)
Sedaia [141]
  • Perpendicular=P=4
  • Base=B=4

Hypotenuse be H

Apply Pythagorean theorem

\\ \tt\hookrightarrow H^2=P^2+B^2

\\ \tt\hookrightarrow H^2=4^2+4^2

\\ \tt\hookrightarrow H^2=32

\\ \tt\hookrightarrow H=\sqrt{32}

\\ \tt\hookrightarrow H=5.8units

8 0
2 years ago
Other questions:
  • Find the volume of a sphere with a great circle area of 201.06 square inches
    10·1 answer
  • (4,7)(-12,3) into standard form
    7·1 answer
  • 0.8 as a fraction in simplest form
    9·2 answers
  • Please answer it now in two minutes
    11·2 answers
  • Find the value of x in the trapezoid below. Show equations and all work that leads to your answer.
    5·1 answer
  • The mean cholesterol levels of women age 45-59 in Ghana, Nigeria, and Seychelles is 5.1 mmol/1 and the standard deviation is 1.0
    6·1 answer
  • Help plz?????????????????
    5·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • What is 4.51 • 3.4 I need to know for a test
    8·1 answer
  • What is the slope of the line that passes through the points (2,0) and
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!