Forests and prairies are examples of ecosystems on land. An ecosystem is a community of living things. Members survive by interacting with each other and with their environment. At first glance, the ocean seems like one big ecosystem.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
<h3>
The supplements that are minerals are</h3>
- calcium
- sodium
- iron
- zinc
<u><em> Explanation</em></u>
- calcium and sodium are major minerals which are required by the body for
calcium- needed for muscle,hearing bone and for the support of synthesis and function of cells
sodium- is needed to control blood pressure and also for proper muscle and nerve function
- Zinc and iron are required in trace and both are needed for good health
Answer:
The volume of the gas sample at standard pressure is <u>819.5ml</u>
Explanation:
Solution Given:
let volume be V and temperature be T and pressure be P.
1 torr= 1 mmhg
42.2 torr=42.2 mmhg
so,
Now
firstly we need to find the pressure due to gas along by subtracting the vapor pressure of water.
=735-42.2=692.8 mmhg
Now
By using combined gas law equation:
Here 
are standard pressure and temperature respectively.
we have
Substituting value, we get
