1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vaselesa [24]
3 years ago
15

Where do the light-dependent reactions take place

Biology
2 answers:
madam [21]3 years ago
8 0
Thylakoid membranes
NNADVOKAT [17]3 years ago
8 0
Thylakoid memuner that's the answer
You might be interested in
Photosynthetic cyanobacteria created what important component of the atmosphere?
horrorfan [7]
C because oxygen was a byproduct of photosynthesis and proved to be EXTREMELY important in the atmosphere.
7 0
3 years ago
When providing care for a child immediately after a bone marrow aspiration, which nursing action is priority?
xxMikexx [17]

Answer: Monitor the site dressing and vital signs.

Explanation:

The bone marrow is the soft tissue inside bones that helps form blood cells. It is made up of a liquid part and a more solid part.  And it is found in the hollow part of most bones. The bone marrow is

The biopsy and bone marrow aspiration are usually done at the same time. Together, these two procedures may be called a bone marrow study.

Marrow aspiration is the removal of a small amount of this tissue in liquid form for testing. Bone marrow biopsy and bone marrow aspiration are procedures that allow samples of bone marrow (the spongy tissue inside some of the longer bones) to be removed and tested.  In a bone marrow biopsy, the doctor uses a needle to remove a sample of the solid part. In a bone marrow aspiration, a needle is used to remove a sample of the liquid part.

<u>Bone marrow aspiration and biopsy may indicate whether the bone marrow is healthy and producing normal amounts of blood cells</u>. Doctors use these procedures to diagnose and monitor blood and marrow diseases, such as some cancers and fevers of unknown origin.  <u>After the procedure, it is important to control the wound so that it does not become infected, and to monitor vital signs.</u>

7 0
3 years ago
I need help, I don't understand this, so please try to explain?
Vinvika [58]

Answer:

Yeah, so basically the image is showing restriction enzymes. The job of restriction enzymes is mainly involved in research when scientists use them for cloning human genes. But that's besides the point...

Main thing you have to understand is that restriction enzymes cut at very specific places along DNA sequences. If you look at the restriction enzyme Rsa 1, you can notice that it cuts only between a thymine nucleotide base and an adenine nucleotide base. Next, if ya look at Sty 1 (be careful b/c W can represent adenine or thymine), it cuts only between two directly adjacent cytosine nucleotide bases!

SO.... if we go to Rsa 1, we can find the answers by dividing up the sequences between the pattern we saw in the gray box. It only cuts between adenine and thymine bases. Based on that, we can find the number of fragments created, and the segment lengths (basically just like how many nucleotide bases are in each strand). Hope ya found this helpful!

3 0
3 years ago
Which statement is correct concerning the process of ecological succession? Shrubs will replace pines during succession. Primary
Mariana [72]

Answer:

Option (2).

Explanation:

Ecological succession is the change in the ecological community of the species with respect to time. Two  types of the succession are  secondary succession and primary succession.

The ecological succession includes various transitional stages before reaching to the climax community. The simple species acquires first and then the climax species is reached at the end of the succession. Different changes are involved in the formation of climax community.

Thus, the correct answer is option (2).

3 0
3 years ago
Which one of the following characteristics is not used to classify angiosperms?
Vikentia [17]
C. Color of leaves

If the question goes like this: Which best describes plant classification? <span>
A.      Nonvascular plants are grouped into seedless and seeded plants. </span><span>
B.       Seedless plants are grouped into gymnosperms and angiosperms.</span> <span>
C.      Gymnosperms are grouped into monocots and dicots. </span><span>
D.       Angiosperms are grouped into monocots and dicots.</span>   <span>

The best answer will be letter D. Angiosperms are grouped into monocots and dicots.</span><span>     Botanists grouped or classified together according to its characteristics. </span>
5 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • The bean sprouts available at the grocery store are white or colorless, not green. Why? Chlorophyll is not synthesized in bean s
    13·1 answer
  • An interaction in which an animal feed on plants is called A) carnivory B) herbivory C) predation D) symbiosis
    8·2 answers
  • In the diagram below, which organelle is a mitochondrion, which provides the
    8·1 answer
  • Which statement accurately describes an interaction between plants and animals? A. Animals release O2, required for plant surviv
    15·2 answers
  • the tendency of minerals to break along smooth, flat surfaces is called _____. Streak fracture cleavage luster
    8·2 answers
  • 8. Which process is responsible for destroying shorelines along seawalls near urban areas?
    10·2 answers
  • HELP<br> The tilt of the Earth causes uneven heating of air on Earth<br> True or False
    7·2 answers
  • B) Give an example of an animal with radial symmetry and an example of an animal with bilateral
    5·1 answer
  • Stacey wants to know if plants have the same phototrophic reaction from artificial light as they do from natural light. Using st
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!