1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ser-zykov [4K]
2 years ago
13

What type of blood is carried by the four major blood vessels entering/leaving the heart?

Biology
1 answer:
Ne4ueva [31]2 years ago
7 0
Deoxygenated blood is carried by pulmonary artery from heart to lungs
Oxygenated blood is carried by pulmonary vein from lungs to heart
You might be interested in
Ras is a GTP-binding protein involved in cell proliferation (division). In its active form, with GTP bound, Ras activates cell s
ArbitrLikvidat [17]

Answer:

E. They decrease the rate at which Ras hydrolyzes GTP.

Explanation:

Activated Ras has GTP bound to it, this propagates an intracellular signal to the nucleus where cell proliferation is induced. Thereafter proliferation is switched off by the hydrolysis of the bound GTP to GDP.

Therefore decreasing the rate of GTP hydrolysis causes Ras to remain active, ultimately leading to uncontrollable proliferation characteristic of cancer.

6 0
3 years ago
If a DNA molecule is compared to a spiral staircase what parts makes up the steps
Burka [1]
<span>pairs of nitrogen bases.  I hope It will halp
</span>
8 0
3 years ago
Read 2 more answers
How our brain changes duriang the whole life?
grigory [225]
The resin why our brain changes throughout our life time as human beings, is simply because of age. Whatever you might learn, or adapt to it will all effect the brain. Everything you do is what your brain makes you do, and it changes with everything you do it all has a huge impact on your brain. Everything, its all about age and time. Hope this was helpful !!
8 0
2 years ago
Technology affects people positively by creating pollution
blagie [28]
Is this a true or false?
8 0
3 years ago
Read 2 more answers
THE THEORY OF EVOLUTION BRINGS MEANING TO LIFE
12345 [234]

Explanation:

Genetic evolution is the meaning of biologic life, in that it is the why and how of it, as well as the stock of future biological existence. The genes that survive -- and in turn the organisms they make -- are the winners in the existence game. ... We owe our existence to this process, and our future depends on it.

7 0
3 years ago
Other questions:
  • When cats are faced with growling dogs, they often arch their backs. Explain how this response might be similar to the ancient o
    8·1 answer
  • 5. What is hypothesis testing?
    15·2 answers
  • An energy pyramid is shown. Which sentence best describes how energy flows through this pyramid? A) Energy is transferred down e
    13·1 answer
  • Rabbit fever is a zoonotic disease caused by
    5·2 answers
  • Refer to the given diagram to answer Question 9
    10·1 answer
  • A zygote is best described as
    11·1 answer
  • Why are echinoderms more advanced than arthropods and mollusks?
    8·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Cuando pasa una molécula de una zona de menor concentración de sustancias a una zona de mayor concentración, el transporte impli
    10·1 answer
  • In photosynthesis, the movement of protons from the stroma to the thylakoid lumen is _______ and is coupled to ________.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!