1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
padilas [110]
3 years ago
10

During human digestion, the bolus enters the stomach through the esophagus via the lower esophageal sphincter. The stomach relea

ses proteases and hydrochloric acid, which kills or inhibits bacteria and provides the acidic pH of 2 for the proteases to work. Food is churned by the stomach through muscular contractions of the wall called peristalsis and the bolus is converted into chyme. According to the text, the stomach's environment is very acidic. How does this acid stay in the stomach?
Biology
1 answer:
AveGali [126]3 years ago
6 0

The stomach is protected from the hydrochloric acid by epithelial cells, which secrete a bicarbonate substance that covers the mucosa. Since the bicarbonate solution is alkaline, it neutralizes the hydrochloric acid produced by parietal cells and subsequently results in formation of water. Importantly, the consistent secretion of the bicarbonate solution is what protects the stomach from the strong acidic environment.





You might be interested in
Are there any producers who don't do photosynthesis?
Bond [772]
Actually yes. You can find organisms, like bacteria, living in deep oceans, which do not have access to sunlight. There are cases in which they use thermal resources in order to produce energy. They are called <span>chemoautotrophs. You can find them around deep ocean "smokers".</span><span />
3 0
3 years ago
Read 2 more answers
[Scientists] can create a "baseline." This gives scientists a point to compare against
miv72 [106K]
C upcoming would be the closest to future
8 0
3 years ago
Read 2 more answers
Which energy source generates radioactive waste?
Misha Larkins [42]

Answer:

a

Explanation:

nuclear fission

6 0
3 years ago
Match the given symbol or molecular formula to the term that best describes it.
Marizza181 [45]
SO2: inorganic compound
k: element
Cl2: inorganic elemental molecule
C6H6: organic compound
5 0
3 years ago
Read 2 more answers
Explain the process by which Amoeba takes its food from the outside to inside the body​
Dovator [93]

Explanation:

Feeding And Digestion In Amoeba

Initially, it pushes out its pseudopodia so that it can encircle the food. After this, it engulfs the food, thus forming a bag-like structure called food vacuole. The process is known as “phagocytosis”. ... Well, the excess food gets stored in the form of glycogen as well as lipids.

8 0
2 years ago
Read 2 more answers
Other questions:
  • When the biceps brachii contracts, the lower arm extends. <br> a. True <br> b. False?
    13·1 answer
  • The boundary where fresh water feeds into salt water is called a(n) _____.
    13·1 answer
  • When DNA was discovered, they saw that the strands of the double helix are lined up in the opposite direction of each other. Wha
    5·1 answer
  • A male cardinal’s red color is an example of a trait affected by natural selection. The females of the species choose mates base
    7·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Drag the tiles to the boxes to form correct pairs. Not all tiles will be used. Match each type of skeletal marking to its functi
    11·2 answers
  • When would a female have a 100% chance of inheriting a sex-linked recessive trait?
    12·1 answer
  • How does photosynthesis start?
    13·1 answer
  • Describe the role of photosynthesis and cellular respiration in ecosystems.
    6·1 answer
  • Differentiate between living things and non living things.​
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!