1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sidana [21]
3 years ago
5

What happens to the velocity of a sound wave in the air if the temperature of the air increases

Biology
1 answer:
Veseljchak [2.6K]3 years ago
5 0

hello i can help you

Molecules at higher temperatures have more energy, thus they can vibrate faster. ... The speed of sound in room temperature air is 346 meters per second. This is faster than 331 meters per second, which is the speed of sound in air at freezing temperatures.

You might be interested in
What does each person do just before becoming infected?
Makovka662 [10]

Answer:

They became careless and transferred to every body saying i cant all of us has to die

7 0
3 years ago
True or False:<br><br> Bacteria are Eukaryotes.
Vilka [71]

Answer:

Bacteria belongs to the Prokaryotes family of microorganisms.

Explanation:

The answer is false.

5 0
3 years ago
Who disproved the concept that the deep sea is simply a dark and lifeless abyss?
Dahasolnce [82]
Its none of them The person who actually disporved it was Charles Wyville Thompson
8 0
3 years ago
Read 2 more answers
Studies of monkeys raised with artificial mothers suggest that mother-infant emotional
madreJ [45]

The correct answer is B. Contact comfort

Explanation:

Studies with Rhesus monkeys were carried out by the psychologists Harry Harlow to study psychological and emotional aspects related to maternal separation and isolation. In this experiment, Harlow used baby monkeys and observed their behavior in different situations that included separating the baby and the mother, providing a fake mother, isolating baby monkeys for a long time and allowing baby monkeys to choose between their mother or food. The results of this experiment showed mother-infant emotional bonds were key for the development and socialization of monkeys, this could be explained as mother monkeys provided contact comfort which supported a positive development and prevailed over food or nourishment.

8 0
3 years ago
Are all cells able to survive on their own?
vfiekz [6]

Answer: No

Explanation: Cells survive in different ways, A cell from your brain could not survive in a Petri dish for very long. It doesn't have the right pieces to live on its own.

6 0
3 years ago
Other questions:
  • How many more trees are there in Canada than florida?
    5·1 answer
  • What kind of stimulus travels from the motor neuron to skeletal muscle?
    10·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Place the following steps in the sharecropping process in the proper order.
    6·1 answer
  • Airplanes reach cruising altitudes at the lower part of the Earth's stratosphere. This portion of the atmosphere is made up most
    6·1 answer
  • What general shape do water molecules have?
    8·2 answers
  • A student writes a term paper about similarities and differences between
    6·1 answer
  • Explain the relationship between surface area
    15·1 answer
  • What are some threats to biodiversity?
    14·1 answer
  • If+the+nucleotide+variability+of+a+locus+equals+0%,+what+is+the+gene+variability+and+number+of+alleles+at+that+locus?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!