1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksley [76]
4 years ago
13

three days after an organism eats some meat many of the organic molecules originally contained in the meat would be found in new

ly formed molecules of?
Biology
1 answer:
Cerrena [4.2K]4 years ago
5 0
Three days after an organism eats some meat, many of the organic molecules originally contained in the meat would be found in newly formed molecules of protein. Proteins are important for all living beings because it is like a fuel source to the body. Proteins are made of amino acid chains and these chains are bonded together with the help of peptide bonds. Proteins also help in the development of tissues in the body. Athletes require more protein than normal humans to keep up their body strength.



You might be interested in
. For the following give the mRNA, tRNA and amino acid (a.a.) sequence that will be created:
alexdok [17]
<span>mRNA: UACAUGGCCUUACGCUAA tRNA: AUG UAC CGG AAU GCG AUU a.a: Tyrosine, Methionine, Alanine, Leucine, and Arginine DNA has 4 different bases, they are Adenine (A), cytosine (C), guanine (G), and Thymine (T). RNA also has 4 bases with three of them being identical to the DNA bases and Thymine being replaced with Uracil (U). These bases are generally represented by the 1st letter of their names. Each of the bases will join with a complementary base, so A always pairs with T or U, and C will pair with G. So to create the mRNA, simply replace every A with a U, every C with a G, every G with a C, and finally, every T with a A. So mRNA: UACAUGGCCUUACGCUAA Now for tRNA, there's a slight twist. It only comes in 3 base codons, You won't find a sequence of tRNA other than in 3 base codons. And each of those codons will be uniquely paired with an amino acid. In the ribosomes, the mRNA will be sequentially scanned 3 bases at a time allowing for a matching tRNA sequence to bind to the exposed 3 bases, this will cause the next amino acid to be bound into the protein being constructed. So split the mRNA into 3 base sequences and calculate the complement to get the tRNA. A simple shortcut is to look at the original DNA sequence and simply replace a T bases with U. So tRNA: AUG UAC CGG AAU GCG AUU Notice the spaces every 3rd base. THIS IS REQUIRED. These is no continuous length of tRNA. You'll only find it in 3 base lengths and each of them will be bound with an amino acid. For the amino acid that's coded to the RNA, you'll need to use a lookup table in your text book, or one you can find online. Then it's a simple matter of matching each 3 base sequence to the amino acid. For the sequence given we have: AUG - Tyrosine UAC - Methionine CGG - Alanine AAU - Leucine GCG - Arginine AUU - STOP Notice the AUU doesn't decode to a specific amino acid. It instead indicates to the ribosome to stop the production of the protein. So the amino acid sequence for the originally given DNA sequence is: Tyrosine, Methionine, Alanine, Leucine, and Arginine.</span>
8 0
4 years ago
Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5′−GGCCCUUUUACCCGGUUUU−3′
Blizzard [7]

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

4 0
4 years ago
The sun's energy and composition is provided by which of the following?
harkovskaia [24]
I am pretty sure that your answer is C or D. Im not sure between the two which. Sorry. 
3 0
3 years ago
How do prions disrupt the normal function of an organism and cause diseases such as mad cow disease?
aev [14]

Answer:

Prions causes abnormal folding of the prion proteins in the brain.

Explanation:

Prions are the abnormal infectious agents composed only of the proteins and no nucleic acids. The prions cause several neurodegenerative diseases in the humans as well as the mammals.

The prions cause the cow mad disease in the cows by affecting the brain of the cow as the prions act on the prion proteins present in the brain only and change their conformation. This leads to the degeneration of the neurons and causes tiny pores in the brain giving sponge-like appearance.

This slows down the mental activity and thus ultimately leads to the death of the cow.

3 0
3 years ago
Neuroticism, psychoticism, and extraversion are the three dominant personality traits according to __________. A. Paul Costa B.
valentinak56 [21]

The correct answer is B. Hans Eysenck.

Hans Eysenck has argued that the highest level of taxonomy in personality trait should be represented by three traits of extroversion, neuroticism and psychoticism rather than five traits of Big Five. Hans Eysenck argues that  psychoticism is made up of Lower level of conscientiousness and agreeableness.


7 0
4 years ago
Read 2 more answers
Other questions:
  • Why do areas north of the Arctic Circle in the Northeren Hemisphere experience a polar day lasting for several months during the
    9·1 answer
  • List the causes and symptoms for six disorders of the six endocrine system.
    12·1 answer
  • Why are waves important in science
    5·1 answer
  • What are Monomers joined by?
    10·1 answer
  • list some of the main human activities that contribute to species extinction, do you think such actives can be justified
    9·1 answer
  • A species of starfish preys on sea urchins and mussels. If the starfish is removed from the ecosystem, the mussel population exp
    12·1 answer
  • A student designs an experiment to see if detergent affects the growth of seeds. He sets up 10 seed pots. Five of the seed pots
    8·2 answers
  • How many chromosomes are found in the ova (egg) of a giraffe?
    7·1 answer
  • The use of vaginal inserts of Lactobacillus to restore a healthy acidic environment is an example of
    14·1 answer
  • Which is the BEST explanation for the drastic decrease in the number of dolphins killed after 1975?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!