1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Shtirlitz [24]
3 years ago
11

SOMEONE WHO ACTUALLY KNOW THE ANSWER PLEASE HELP

Biology
2 answers:
yulyashka [42]3 years ago
4 0
The graphing of the possible phenotypes results in a bell curve
Debora [2.8K]3 years ago
3 0
<h3><u>Answer;</u></h3>

The graphing of the possible phenotypes results in a bell curve.

<h3><u>Explanation;</u></h3>
  • <u>Polygenic traits are traits that are determined by more than one gene.</u> These types of traits have many possible phenotypes that are determined by interactions among several alleles.Examples of polygenic traits are skin color, eye color, body shape, height and weight among others.
  • <u>Polygenic traits tend to result in a distribution that resembles a bell-shaped curve,</u> <em><u>with few at the extremes and most in the middle. In the bell-shaped distribution individuals that inherit various combinations of dominant and recessive alleles fall in the middle of the curve.  Individuals who inherit all dominant alleles or all recessive alleles fall at ends of the curve.</u></em>
You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
A man of healthy weight may have, on the average, ____ percent of his body weight as fat.
Nat2105 [25]
The correct answer is 20% on average. The ideal percentage rate of a healthy man with normal weight is 18 to 22%. However, a range of 7-13% is considered normal for male professional athletes, because their muscular mass is much greater. The physiological minimum rate which is acceptable for males is 4-6%.
5 0
3 years ago
Read 2 more answers
The stomata you view on the surface of the leaves are used in gas exchange and the guard cells regulate this exchange. What do y
beks73 [17]

Answer:

They will collapse and shut off the stomatal pore

Explanation:

The guard cells are regulated by the presence of water. When water is present, they become turgid and open up the stomatal pore and when water is inadequate, they become flaccid, collapse and close up the stomatal pore as a result.

<em>If the leaf is left under the microscope for too long, there will be loss of water by evapotranspiration and the guard cell will become flaccid and collapse as a result and the stomatal pore will become closed.</em>

8 0
4 years ago
Possible explanations for the origin of life in structure, function, and behavior among
Sladkaya [172]

Answer:

D. Cell Theory

4 0
3 years ago
Read 2 more answers
In a typical marine food chain, which role do small, herbivorous fish occupy?
vladimir2022 [97]
Small herbivorous fish would occupy the role of a C. primary consumer. Primary consumers consume primary producers, and primary consumers are then consumed by secondary consumers. Once secondary consumers die, they are consumed oftentimes by decomposers.

Hope this helps!
8 0
3 years ago
Read 2 more answers
Other questions:
  • Imagine you are a red blood cell sitting in the right atria of the heart. in your laboratory journal, write a paragraph that des
    13·1 answer
  • Iodine products that are used on human tissues as anti-infection agents are called
    5·1 answer
  • Suppose that when you examined your tubes (in this exercise) after incubating them, you noticed that the unsealed control contai
    12·1 answer
  • Which change of state occurs at 100 °C when heat energy has been added to liquid water?
    5·2 answers
  • In tomatoes, round fruit (R) is dominant over long fruit (r), and smooth skin (S) is dominant over fuzzy skin (s). A true-breedi
    13·1 answer
  • How does a white blood cells structure help it perform its function?
    11·1 answer
  • Water is one of the required reactants for photosynthesis. It provides electrons which are energized by sunlight and used to mak
    9·2 answers
  • Fever ________. Group of answer choices: a) decreases the metabolic rate of the body to conserve energy b) causes the liver to r
    7·1 answer
  • Which would best keep the oxygen cycle stable?
    9·2 answers
  • Can skin cells be a part of a heart?<br> Why or why not?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!