1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oliga [24]
4 years ago
13

3. Write the complimentary sequence of DNA for the following strand:

Biology
1 answer:
garik1379 [7]4 years ago
5 0
The correct answer is TTAATCCTCGGGTCGAAACGGCT

This is because whenever you’re trying to find the complementary sequence of DNA, you basically switch which the listed base and it’s correspondent.

Adenine -> Thymine
Cytosine -> Guanine

Hope this helps!! :)
You might be interested in
To which of the same groups do the raccoon and the guinea pig belong
Svetllana [295]
The guinea pig and the raccoon are both members of :
The eukarya domain, the kingdom of animals, the chordates and the mammal class.
After the level of class (Mammalia), they start to belong to different groups.
The guinea pig belongs to rodents and the raccoon belongs to the carnivores.
5 0
4 years ago
1. 80 feet<br> 2. 40 feet <br> 3. 20 feet<br> 4. 30 feet
andrey2020 [161]

Answer:

30 feet

Explanation:

7 0
3 years ago
Which of the following is NOT a component of cell theory? *
alina1380 [7]

Answer:

3. All cells have membrane-bound organelles

Explanation:

3 0
3 years ago
The movement of large molecules through the cell membrane out of the cell is called ______.
xenn [34]

Answer:

A

Explanation:

Osmosis is a process by which molecules of a solvent tend to pass through a semipermeable membrane from a less concentrated solution into a more concentrated one, thus equalizing the concentrations on each side of the membrane.

6 0
3 years ago
Read 2 more answers
Which statement best defines a community?
lesya692 [45]
I believe all populations of organisms in an area
3 0
3 years ago
Other questions:
  • A microscope has different magnification powers. Using the If . . . , then . . . format, write a hypothesis that answers the lab
    8·2 answers
  • What is an example of a chemical factor indicating the health of a freshwater body of water? A. pH levels B. temperature C. turb
    14·1 answer
  • PLEASEE HELPP MEE !!!!!
    6·1 answer
  • What is the difference between a point source and a nonpoint source of water pollution? a a nonpoint source is easily identifiab
    15·1 answer
  • Which of the four species of plasmodium is the most dangerous?
    15·1 answer
  • IIdentify the kingdoms. Check all that apply. Eubacteria Archaebacteria Archaea Protista Fungi Plantae Animalia Eukarya
    11·2 answers
  • How do plants obtain energy for photosynthesis?​
    6·2 answers
  • The ________ are a diverse group of organic substances including triglycerides, phospholipids, and the sterols.
    15·1 answer
  • Where is the epicenter of an earthquake?
    14·2 answers
  • HELP ME PLEASEE forget
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!