Please pay attention in class next time but I will explain a haploid has one pair of chromosomes while diploids have two pairs
The answer is B
Answer:
The part of the cell cycle in which DNA is synthesized is the S phase of the Interface
Explanation:
The interphase has 3 phases before the mitosis.
G1 where the cell mass and volume are doubled
S The ADN synthesis, that's why it is called S phase
and G2, where the chromosome duplication occurs.
Q1)
the sequence given, we need to read from 5' to 3' and find where the reading frame starts. That's where atg is found.
<span>5’ agcggg atg agcgcatgtggcgcataactg3’
from here onwards we have to separate the bases into groups of three as these are codons that each code for an amino acid.
</span><span>5’ agcggg atg agc gca tgt ggc gca taa ctg 3’
Met Ser Ala Cys Gly Ala stop
TAA(UAA in mRNA ) is the stop codon so reading frame stops here
we change base A to T (capitalised)
DNA sequence with amino acids are given
</span>5’ agcggg atg Tgc gca tgt ggc gca taa ctg 3’
N Met Cys Ala Cys Gly Ala stop
after changing the base the amino acid sequence changes from Ser to Cys.
Q2)
the complementary strand of the above strand is as follows <span>
5' cagttatgcgccacatgcgctcatcccgct 3'
start codon starts with atg thats where the reading frame starts
</span>5' cagtt atg cgc cac atg cgc tca tcc cgc t 3'
Met Arg His Met Arg Ser Ser Arg
After changing base from A to T, the complementary strand changes from T to A (capitalised)
5' cagtt atg cgc cac atg cgc Aca tcc cgc t 3'
Met Arg His Met Arg Thr Ser Arg
amino acid changes from Ser to Thr.
Q3)
The sequence with amino acids before inserting a base is
5’ agcggg atg agc gca tgt ggc gca taa ctg 3’
Met Ser Ala Cys Gly Ala stop
We insert a base G shown in capitals
5’ agcggg atg agc Ggca tgt ggc gca taa ctg 3’
This changes the codons of bases after the inserted base
5’ agcggg atg agc ggc atg tgg cgc ata act g 3’
Met Ser Gly Met Trp Arg Ile Thr
the amino acid completely changes from Met Ser Ala Cys Gly Ala
to Met Ser Gly Met Trp Arg Ile Thr
Q4)
the complementary strand before adding a base is
5' cagtt atg cgc cac atg cgc tca tcc cgc t 3'
Met Arg His Met Arg Ser Ser Arg
When we insert a base G, base C is added to the complementary strand
5' cagtt atg cgc cac atg cCgc tca tcc cgc t 3'
this changes the codons
5' cagtt atg cgc cac atg cCg ctc atc ccg ct 3'
Met Arg His Met Pro Leu Ile Pro
With insertion of one base the amino acid sequence changes from
Met Arg His Met Arg Ser Ser Arg
to Met Arg His Met Pro Leu Ile Pro
Answer:
Ocean is the answer. Because it consists in fresh waters and marine
The 2020 ICD-10-CM diagnosis code for cocaine abuse is F14.10
Explanation:
ICD code F01-F99 refers to mental, behavioral, and neuro-developmental disorders.
ICD code F14 stands for cocaine related disorders and F14.1 indicates cocaine abuse.
Cocaine is an addictive illicit drug and abuse effect the body and causes both physical and psychological symptoms.
Short-term signs or effects due to cocaine abuse includes dilated pupils, body temperature, erratic or rapid pulse, high blood pressure and increased heart rate, increased respiratory rate, dilated pupils, lack of appetite and sleep, hyperstimulation with erratic or violent behavior, panic, psychosis etc. Based on the patient’s symptoms and vital signs, the patient’s diagnosis would be cocaine abuse.
