1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anuta_ua [19.1K]
4 years ago
7

What was added to Dalton's theory as it was modified?

Biology
1 answer:
Alja [10]4 years ago
5 0
JJ Thomson added to Daltons theory by discovering the electron. He explained that the atom is a positive ball with negative electrons.
You might be interested in
Which process occurs as various body parts form in a developing embryo?
Vsevolod [243]

Answer:

The correct answer is differentiation.

Explanation:

The process of development during which the cells of the embryo specialize and the origination of different tissue compositions take place is known as embryonic differentiation. An organism is formed of distinct cell types, with each exhibiting specific functions. During embryogenesis, differentiation of cells is essential for the cell, organ, tissue, and organism's identity.

With the development of an embryo, the individual cells start to differentiate. In the embryo, the differentiation of cells takes place by both extracellular and internal cellular factors. The phenomenon of embryonic development plays an essential part in the proper development of an organism.

4 0
3 years ago
DNA provides the blueprint for the synthesis of proteins. A _______ is a segment of DNA that codes for one particular protein.
Georgia [21]
That's Gen is a segment of DNA
8 0
4 years ago
Read 2 more answers
Differentiate between photosynthesis and respiration​
castortr0y [4]
The are opposite processes. Photosynthesis requires carbon dioxide, water and sunlight to create oxygen and glucose. Where cellular respiration requires oxygen and glucose to create ATP energy, and carbon dioxide and water as waste products. Since the processes are opposite of each other they are in a never ending cycle. One provides the other with the necessary reactants to create the products
8 0
3 years ago
HELP!<br> Explain why siblings may share similarities but are not identical.
bixtya [17]

Answer:

recombination

Explanation:

Since of recombination, kin as it were share approximately 50 percent of the same DNA, on normal.  So whereas organic kin have the same family tree, their hereditary code can be distinctive in at slightest one of the zones looked at in a given test. That's genuine indeed for intimate twins.

6 0
3 years ago
What is a type of cell division that results in diploid cells
8_murik_8 [283]

Answer: mitosis

Explanation:

6 0
3 years ago
Other questions:
  • Stitching of the large tissue that acts as a tendon and attaches muscles to bone is called
    5·1 answer
  • What process makes life possible on earth?
    15·2 answers
  • The three agents of metamorphism are _____. melting, pressure, and weathering heat, pressure, and hydrothermal solutions heat, e
    5·2 answers
  • Similarities and differences between nitrogen cycle and carbon cycle
    15·1 answer
  • Which of the following properties of water allow plants to maintain
    10·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • The ? causes seasonal variations in day length to all locations of the equator
    10·1 answer
  • Healthy ecosystems depend on–
    11·2 answers
  • 1.What similarities do you notice in what happened to the population with mutations and to the population without mutations?
    8·1 answer
  • In the viable plate count method, a measured sample of a culture is evenly spread across an agar surface and incubated. Each ___
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!