1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dedylja [7]
3 years ago
7

What role do other human body systems, such as the digestive system, the integumentary system, and the respiratory system play i

n protection? Think back to the game or children’s book you designed in PBS. Provide an example for each system that demonstrates how a feature, substance, or action of that system helps keep you well.
Biology
1 answer:
Yakvenalex [24]3 years ago
7 0
Respiratory system helps in breathing and it leads to exhalation of the gas carbon dioxide which is not required by the body. The integumentary system is the first line of defense and protects the body from invadig microbes, dust, and other harmful substances. The digestive system protects the body by enabling digestio of food and providing energy to sustain, further the toxic waste materials are also released during the process. 
You might be interested in
14.
KiRa [710]
Liver is the answer
7 0
3 years ago
If vascular plants have so many advantages, why do nonvascular plants still exist on Earth today?
pochemuha
Because they easily take over farmlands
8 0
3 years ago
Read 2 more answers
Please answer!!! <br> A b c or d
agasfer [191]

Answer:

I'll give this a shot I think it's B!

Explanation:

4 0
3 years ago
Im doing a review for earth science i dont know what this answer is and cant find it in my book but what is rebound?
Vlada [557]
Rebound means <span>bounce back through the air after hitting a hard surface or object</span>
7 0
4 years ago
Read 2 more answers
The elimination of a predator has no negative impacts on that predator’s prey species.
Anna35 [415]

Hello,



Answer: False. If the predator is eliminated, overpopulation and food shortages can result



If you loved this answer why not hit that cool Mark Brianliest button!

7 0
3 years ago
Read 2 more answers
Other questions:
  • most matter in the natural world is a mixture of substances. Consider seawater, dirt, and plants. Explain why each of these exam
    6·2 answers
  • All of the following characteristics are used to classify living organisms EXCEPT –
    10·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • In the mouse, gene A allows pigmentation to be deposited in the individual coat hairs; its allele a prevents such deposition of
    12·1 answer
  • Cyclin-dependent kinases (Cdks) are enzymes involved with the control of mitosis; Drs. Lee Hartwell and Paul Nurse won the Nobel
    8·1 answer
  • Which is a method that uses bacteria to copy dna?
    8·1 answer
  • When sodium chloride is dissolved in water the sodium ions do what​
    10·1 answer
  • What are the minor functions of the cardiovascular system
    15·1 answer
  • Urmmm.. so i need help againnn..
    5·1 answer
  • There are economic concerns surrounding the products that have been genetically engineered for particular traits, including phar
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!