1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
7nadin3 [17]
3 years ago
11

What is the frequency in vibrations per second of a 200 hertz wave?

Biology
1 answer:
Annette [7]3 years ago
8 0
Once you understand this, its pretty simple. 50 hertz= 50 vibrations. 100 hertz=100 vibration. So to answer your question 200 hertz=200 vibrations. Your answer is C. 
You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
Please help I dot understand
denis-greek [22]

Answer:

Reject some alternative hypothesis.

8 0
3 years ago
What is the name of the process that requires energy (adenosine triphosphate, or atp) for digested nutrients to be absorbed thro
SVEN [57.7K]
The name of the process that needs energy (adenosine triphosphate, or atp) for  nutrients that were digested to be absorbed through the small intestinal wall into the bloodstream or lymphatic system is called active transport. This process involves the movement of particles in a membrane from a lower concentration to a higher concentration with the aid of an external source like energy or enzymes.
4 0
3 years ago
In a certain population of red squirrele, a mutation causes several squirrels to
mihalych1998 [28]

Answer:

in a certain population of red squirrele, a mutation causes several squirrels to

be bom with darker coats. These coats make the squirrels nearly inweible

when they are foraging on the forest floor , According to the theory of evolution by natural selection, what is likely to  happen to this trait after several generations?

After several generations, this trait is likely to be much more  common because individuals with the trait will have a greater  chance of passing it on to their offspring,

Explanation:

It would later turn to what is termed as germline mutation which are mutations passed from parent to offspring, as time progresses the trait would be more and increases the chance of being transferred to their offspring

3 0
3 years ago
Read 2 more answers
Most of the lymph returns to the venous circulation by way of the ______.
ohaa [14]
The correct answer is "thoracic duct". 

The thoracic duct (also called as the left lymphatic duct or the alimentary duct) is the structure wherein most of the lymph in the drained from the lymphatic vessels goes to this structure. In the thoracic duct, lymph flows up to the level of the brachiocephalic vein where lymph returns to the venous circulation.
8 0
4 years ago
Other questions:
  • Why does a year consist of 365 days and a day of 24 hours?
    15·1 answer
  • Tapping the triceps brachii muscle tendon will result in reflexive elbow extension. this is an example of a ____________ reflex.
    6·1 answer
  • Photosynthesis is an example of
    15·2 answers
  • Why does DNA migrate to the positive electrode?
    15·1 answer
  • The system that helps all other systems maintain homeostasis by transporting oxygen and nutrients carbon dioxide and waste is th
    8·2 answers
  • Why lack of vacuole in meristematic tissues
    10·1 answer
  • What do the THREE components of Cell Theory state?
    6·2 answers
  • 10. What statement is true about embryonic stem cells and adult stem cells?
    13·2 answers
  • Megan examines a liver cell and observes an organelle with many smooth-
    11·1 answer
  • What is a job of the muscular system?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!