Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
an allele is a form ofa gene
Answer:
Liver cells would need a large number of mitochondria to function and survive as alot of energy is required to detoxify the toxic material and also aids in insulin production when sugar level is high or intake of sugar becomes high
so correct option is C.
If this answer helped you, give this answer a heart, rate it and if you could then please mark it brainliest. Thanks!
Answer:
10x5x6 in this order=300
Explanation:
10x5 is 50
50x6 is 300 :) hope this helps
Bison are gazers. They live in herds and they migrate in search of better pastures. Bisons live in the grasslands. The grassland biome is when the <span>lands are dominated by grasses as opposed to trees and shrubs.</span>
