1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pentagon [3]
3 years ago
13

HELP ASAP AND ILL GIVE U BRAINLIEST

Chemistry
1 answer:
Papessa [141]3 years ago
5 0

Definition-the quantity of matter that a body contains, as measured by its acceleration under a given force or by the force exerted on it by a gravitational field  (in general use) weight.

c. It is the amount of matter in the object.

Hope this helps.

You might be interested in
Describe the structure of dry cell​
Sedbober [7]

Answer:

Dry Cell was an American rock band formed in 1998 in California, United States, known in earlier stages as Impure. They are best known for their song "Body Crumbles", which was featured in numerous third party media, such as

Explanation:

Thank me later

4 0
2 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Boron’s chemistry is not typical of its group.(a) Cite three ways in which boron and its compounds differ significantly from the
Mila [183]

Boron’s chemistry is not typical of its group. is group 3A (13) shows the increasing metallic character from Al to Tl.

All Boron compounds are covalent whereas the other elements in group 3A (13) form mostly ionic compounds.

Except for Boron, the other elements of group 3A (13) show increasing metallic character from Al to Tl. But Boron is a metalloid.

Compared to the other elements in group 3A, boron has a lower reactivity in chemical terms (13)

The metalloid boron (B), as well as the metals aluminium (Al), gallium (Ga), indium (In), and thallium, are all part of group 3A (or IIIA) of the periodic table (Tl). In contrast to the other members of Group 3A, the element borax primarily forms covalent connections.

To learn more about group 3A (13) refer the link:

brainly.com/question/5489194

#SPJ4

6 0
1 year ago
Which of the following is true of groups on the periodic table? A. Groups are horizontal and do not have the same properties. B.
Stells [14]
<span>Groups are vertical, numbered 1 through 18, and have similar properties, so answer D. Most of the properties of groups are defined by the outermost electron in the shells of the elements. Horizontal delineations in the Periodic Table are known as periods.</span>
3 0
3 years ago
Like a greenhouse gas, clouds can trap heat emitted from the earth's surface.
olga_2 [115]
True. Because they are white we know that they reflect light, and thus heat.
8 0
3 years ago
Read 2 more answers
Other questions:
  • What is the volume in liters of 321 g of liquid with a density of 0.84 g/mL
    6·1 answer
  • ball has a volume of 5.27 liters and is at a temperature of 27.0°C. A pressure gauge attached to the ball reads 0.25 atmosphere.
    13·1 answer
  • Which amino acid(s) are metabolites in the urea cycle, but are not used as building blocks of proteins? A) Ornithine B) Citrilli
    5·1 answer
  • Considering the side chain of each of the amino acids at pH 7.4, is that amino acid classified at neutral, basic, or acidic? You
    7·1 answer
  • What is the molar mass of the anhydrous compound? Answer using four significant figures.
    10·2 answers
  • A 0 point 5 kg arrow was shot at a target. The arrow accelerated at 200 meters per second squared. What was the net force on the
    9·1 answer
  • Alisha organizes her data about the element lead into a table.
    12·2 answers
  • Compound A has 4 moles of hydrogen, 4 moles of oxygen, and
    9·1 answer
  • Plzzz help pls How many liters are in 6.74 x 1023 particles of PbCl2?
    5·1 answer
  • 1. Why is it a problem that most black-footed ferrets today are closely related?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!